ID: 1189985414

View in Genome Browser
Species Human (GRCh38)
Location X:46549214-46549236
Sequence TTTCTTTTCTGAAATGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189985413_1189985414 -8 Left 1189985413 X:46549199-46549221 CCTTTGCATTGTCACTTTCTTTT No data
Right 1189985414 X:46549214-46549236 TTTCTTTTCTGAAATGAAAATGG No data
1189985412_1189985414 -5 Left 1189985412 X:46549196-46549218 CCACCTTTGCATTGTCACTTTCT No data
Right 1189985414 X:46549214-46549236 TTTCTTTTCTGAAATGAAAATGG No data
1189985410_1189985414 12 Left 1189985410 X:46549179-46549201 CCCTCTGTGTCTCAAGTCCACCT No data
Right 1189985414 X:46549214-46549236 TTTCTTTTCTGAAATGAAAATGG No data
1189985408_1189985414 26 Left 1189985408 X:46549165-46549187 CCAGGTTCCTTTTTCCCTCTGTG No data
Right 1189985414 X:46549214-46549236 TTTCTTTTCTGAAATGAAAATGG No data
1189985409_1189985414 19 Left 1189985409 X:46549172-46549194 CCTTTTTCCCTCTGTGTCTCAAG No data
Right 1189985414 X:46549214-46549236 TTTCTTTTCTGAAATGAAAATGG No data
1189985411_1189985414 11 Left 1189985411 X:46549180-46549202 CCTCTGTGTCTCAAGTCCACCTT No data
Right 1189985414 X:46549214-46549236 TTTCTTTTCTGAAATGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189985414 Original CRISPR TTTCTTTTCTGAAATGAAAA TGG Intergenic
No off target data available for this crispr