ID: 1189986062

View in Genome Browser
Species Human (GRCh38)
Location X:46554291-46554313
Sequence GCTCAAGTATGTGCACTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189986062_1189986066 8 Left 1189986062 X:46554291-46554313 CCTCTTAGTGCACATACTTGAGC No data
Right 1189986066 X:46554322-46554344 CTAACTCCTGATATCTTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189986062 Original CRISPR GCTCAAGTATGTGCACTAAG AGG (reversed) Intergenic
No off target data available for this crispr