ID: 1189988122

View in Genome Browser
Species Human (GRCh38)
Location X:46571736-46571758
Sequence ATCCCAGCACAAGGCCGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189988119_1189988122 2 Left 1189988119 X:46571711-46571733 CCAGGCACAGTAGCTCAGGCCTG 0: 9
1: 805
2: 18439
3: 64107
4: 130340
Right 1189988122 X:46571736-46571758 ATCCCAGCACAAGGCCGAAGTGG No data
1189988114_1189988122 29 Left 1189988114 X:46571684-46571706 CCTACTTGCTTAAAAGATGAGAG No data
Right 1189988122 X:46571736-46571758 ATCCCAGCACAAGGCCGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189988122 Original CRISPR ATCCCAGCACAAGGCCGAAG TGG Intergenic
No off target data available for this crispr