ID: 1189989217

View in Genome Browser
Species Human (GRCh38)
Location X:46578581-46578603
Sequence TTTTTTGCAAAGATTGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 559
Summary {0: 1, 1: 0, 2: 5, 3: 75, 4: 478}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189989212_1189989217 7 Left 1189989212 X:46578551-46578573 CCACCACTCAATCTCATTAAAAG 0: 1
1: 0
2: 1
3: 10
4: 178
Right 1189989217 X:46578581-46578603 TTTTTTGCAAAGATTGGGGATGG 0: 1
1: 0
2: 5
3: 75
4: 478
1189989213_1189989217 4 Left 1189989213 X:46578554-46578576 CCACTCAATCTCATTAAAAGAAA 0: 1
1: 1
2: 2
3: 51
4: 414
Right 1189989217 X:46578581-46578603 TTTTTTGCAAAGATTGGGGATGG 0: 1
1: 0
2: 5
3: 75
4: 478

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189989217 Original CRISPR TTTTTTGCAAAGATTGGGGA TGG Intronic
900945418 1:5828587-5828609 TCTTTTGCCAGGAGTGGGGATGG + Intergenic
901287365 1:8091549-8091571 TTTTTTGCAGAGATGGGGTTTGG + Intergenic
902139503 1:14341063-14341085 TTTTTAGTAGAGATTGGGGGGGG + Intergenic
903076248 1:20769265-20769287 TTTTTTGTAAAGGCTGGGCATGG + Intronic
903246049 1:22016330-22016352 TTTTTTGCGGGGGTTGGGGACGG + Intergenic
905071158 1:35226538-35226560 TTTTGTGTAGAGATTGGGGAGGG + Intergenic
908292948 1:62686947-62686969 TTTTTTGCAGAGATGGGGTGGGG + Intronic
908667616 1:66510229-66510251 TGTTTTGCAAACAATGTGGACGG - Intergenic
908888446 1:68816894-68816916 ACTTTTGCAAATATTGAGGAAGG + Intergenic
909198019 1:72650811-72650833 TTTTTTTCAAAAATTGGTGAGGG + Intergenic
909559121 1:76990197-76990219 TTTTTGGTGGAGATTGGGGATGG - Intronic
909629241 1:77753414-77753436 TTTTTTGTAAAGATGGGGGGTGG - Intronic
909643496 1:77891903-77891925 TTTTTTGTAGAGATGGGGGTGGG - Intronic
911552423 1:99299656-99299678 CTTTTTGTAAAGTTTGAGGAGGG + Intronic
911991339 1:104701253-104701275 TTTTTTGCAAAGAAGTGGGAGGG - Intergenic
913237388 1:116796622-116796644 TTTATGGAGAAGATTGGGGAAGG + Intergenic
913663675 1:121028463-121028485 TTATCTGCAAAGATTGGGAAAGG + Intergenic
914015073 1:143811744-143811766 TTATCTGCAAAGATTGGGAAAGG + Intergenic
914162748 1:145149481-145149503 TTATCTGCAAAGATTGGGAAAGG - Intergenic
914319902 1:146549113-146549135 ATTTTTCCACAGATTGGGGGTGG - Intergenic
914511367 1:148335134-148335156 TTCCTTGGAAAGATTGGGGCGGG - Intergenic
914653691 1:149720284-149720306 TTATCTGCAAAGATTGGGAAAGG + Intergenic
915423730 1:155806459-155806481 TTTTTTGTAGAGATGGGGGTGGG + Intronic
915685885 1:157633609-157633631 TGGTTATCAAAGATTGGGGAGGG + Intergenic
915773724 1:158459206-158459228 TCTATTGCAAAGATTGAGGTAGG + Intergenic
917819931 1:178752325-178752347 TTTTTTGTAGAGATTGGTGGCGG + Intronic
918019136 1:180667649-180667671 TTTTTTGGAAAAGTTTGGGAAGG + Intronic
918019137 1:180667650-180667672 TTTTTGGAAAAGTTTGGGAAGGG + Intronic
918908033 1:190525095-190525117 TTTTTTTCATGGATTGGGAAAGG - Intergenic
919674703 1:200369749-200369771 TTTTTAGCAGAGGATGGGGATGG - Intergenic
919741456 1:200983704-200983726 CTTTTTGGAAGGATTGGGGCAGG - Intronic
920670056 1:207996922-207996944 TTCTCTGCAGAGACTGGGGATGG - Intergenic
920912489 1:210232300-210232322 TCTTTTGCAAAGGGTGGGAAAGG + Intergenic
921362818 1:214345695-214345717 TTCTTTCCAGAGGTTGGGGATGG + Intergenic
921458032 1:215395284-215395306 TTTTTAGTAGAGATGGGGGACGG + Intergenic
921640271 1:217544758-217544780 TTGTTTGCTAAGGTGGGGGATGG - Intronic
922970012 1:229728269-229728291 TATTTTGTAAAGAATTGGGAAGG - Intergenic
923050751 1:230389855-230389877 ATGTTTGCAATGATTTGGGATGG + Intronic
923741251 1:236657084-236657106 TTTTATGCAAACAGTGGGGCTGG + Intergenic
923883656 1:238131253-238131275 TTTTTTGTAGAGATGGGGGGGGG + Intergenic
923892302 1:238229289-238229311 TTTGTGGCCAGGATTGGGGATGG - Intergenic
923954932 1:239005548-239005570 TTTTTTGCAGTGATTGCAGATGG - Intergenic
924530511 1:244889812-244889834 TTTTTTTAAGAGATTGGGGATGG + Intergenic
924818696 1:247466473-247466495 AATTTTGGAAAGAATGGGGAGGG - Intergenic
924876168 1:248106746-248106768 TTTTTTGTAAAGAGTAGGGAAGG + Intergenic
1062890757 10:1057451-1057473 TTCTCTCCAAAGAGTGGGGATGG + Intronic
1063671380 10:8102670-8102692 TTTTTTGTAAAGATTGGGGTGGG - Intergenic
1064761256 10:18623783-18623805 TTTTTTCCAGAGGGTGGGGAAGG - Intronic
1064920448 10:20511229-20511251 TATTTTGCAAAGGATGAGGAGGG + Intergenic
1065160587 10:22916974-22916996 TTTTTTGTAGAGATTGGGTCTGG + Intergenic
1065768051 10:29050315-29050337 TTCTTTACAAAGATGGGGGCAGG - Intergenic
1066452217 10:35540571-35540593 TTTTTTGAAGAGTTTGTGGAAGG + Intronic
1067836482 10:49644691-49644713 CTTTTTGCAAATCCTGGGGAAGG - Intronic
1068283027 10:54901139-54901161 TTTTTTGTAGAGATGGTGGAGGG - Intronic
1068430573 10:56926697-56926719 TTTATTGTCAAGATTGGTGATGG - Intergenic
1068729934 10:60346086-60346108 TTTGTTACAAAGAGTGAGGAAGG - Intronic
1068895884 10:62200496-62200518 TTTATTGCAAAAGTTTGGGAAGG + Intronic
1069875251 10:71558998-71559020 TTTTCTGCAAGAGTTGGGGAAGG + Intronic
1069878161 10:71575744-71575766 TTATTTCCAAAGACGGGGGATGG - Intronic
1070479477 10:76868368-76868390 TTGTTAGCAAATATTGGAGAAGG + Intergenic
1070795242 10:79212478-79212500 TTTTTTGCACAGATGGGGCTGGG + Intronic
1071319149 10:84435622-84435644 TTTTTTGCACTGAATGGGTAAGG - Intronic
1071513742 10:86283284-86283306 CTATTTGCACAGGTTGGGGAGGG + Intronic
1073134113 10:101210449-101210471 TTTCTTCCAAAGATGGGGCAGGG - Intergenic
1073307241 10:102512889-102512911 TTTTCTGTAGAGATGGGGGAGGG - Intronic
1073343931 10:102767692-102767714 TTTATTGCAGAGGTTGGGGGAGG - Intronic
1075093753 10:119457863-119457885 TTTTTTGTAGAGATGGGGGGGGG + Intronic
1075148149 10:119901030-119901052 TTTTTTTTAAAGAGTGGGGGGGG + Intronic
1075189267 10:120291517-120291539 TTATCTGCAAAGTTGGGGGAAGG - Intergenic
1075290410 10:121225163-121225185 TTTTTTGTAGAGATGGGGGGGGG + Intergenic
1075405024 10:122189167-122189189 GTGTGTGCAGAGATTGGGGAGGG + Intronic
1078149133 11:8743918-8743940 TTTTTTGTAGAGATGGGGGCGGG + Intronic
1078252446 11:9627451-9627473 TTTTTTGTAGAGATTGGGGGGGG + Intergenic
1078908449 11:15709013-15709035 TTTTTTGCCAAGAGAGTGGACGG - Intergenic
1079228094 11:18625742-18625764 TTTTTTGTAGAGATTGGGGGGGG + Intronic
1080328080 11:31101718-31101740 ATTTTTACAAATATTGGGGCAGG - Intronic
1080384771 11:31804817-31804839 TTTTTTGAAATGAGTGAGGAGGG - Intronic
1080672993 11:34398485-34398507 TTTTTTGCAGAGATGGTAGAGGG - Intergenic
1080759340 11:35233080-35233102 TCTTTTGCTGAGATTGGGAAAGG - Intergenic
1081262396 11:40976844-40976866 TTTTTTCCACAGACTGGGGCAGG + Intronic
1081584668 11:44376246-44376268 TTTATTACAAAGAGTGGGGGAGG - Intergenic
1081848634 11:46259694-46259716 TTTTTAGTAGAGATGGGGGAGGG - Intergenic
1084001569 11:66297978-66298000 TTTTTTGTAAAGACGGGGGTGGG - Intergenic
1085565645 11:77511157-77511179 TTTCTTGCAAGGGTTGAGGAAGG + Intergenic
1086891946 11:92268542-92268564 ACTTTTACAAAGAATGGGGAAGG - Intergenic
1087271170 11:96113589-96113611 TTTTTTTCAAACAACGGGGATGG - Intronic
1088058615 11:105615878-105615900 TCTTTTGCAAAATTTGGAGATGG - Intronic
1088768005 11:113003792-113003814 ATCTTTGCAATGATCGGGGAAGG + Intronic
1089358734 11:117872714-117872736 TTTGTTACAAAGATGTGGGAGGG - Intronic
1089761143 11:120724493-120724515 GTTTTTACAATGATTGGAGAAGG + Intronic
1090591133 11:128270211-128270233 ATTTTTCCACAGATTGGGGGTGG - Intergenic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1092531558 12:9349433-9349455 TTTTTTATAAAAATTGGCGAAGG - Intergenic
1092725069 12:11476852-11476874 TATGTTGCAAAGCATGGGGAGGG - Intronic
1092871681 12:12811252-12811274 TTTTTTGCACAGAATTGGGGCGG - Intronic
1093224538 12:16465778-16465800 ATTTTTCCACAGATTGGGGTGGG - Intronic
1093247595 12:16759564-16759586 TTTTCAACAAAGATTGGTGAAGG - Intergenic
1093989246 12:25571651-25571673 TTTTTTGAAAAGGTTGGGAATGG - Intronic
1094203608 12:27817564-27817586 TTTTTTGTAGAGATCGGGGTTGG + Intergenic
1094774773 12:33712918-33712940 TTTTTTGAAAAGAGTGTGGTTGG + Intergenic
1096855224 12:54476597-54476619 TTTTTTGTAGAGATTGGGGGTGG + Intergenic
1097065484 12:56317389-56317411 TGTTTTGCAAAGAATGAAGAAGG + Exonic
1098779593 12:74669956-74669978 TCTTTTGGAAAGATAGTGGAAGG + Intergenic
1100033702 12:90224738-90224760 TTGTTTCCAAAAATTGGGCAAGG - Intergenic
1100472432 12:94905455-94905477 TTTTTTCAAAGGATTGGTGATGG - Intronic
1100755868 12:97750397-97750419 ATTTTTCCATAGACTGGGGATGG + Intergenic
1100787019 12:98089497-98089519 TTTTTGGTAGAGATTAGGGAGGG - Intergenic
1100846920 12:98668749-98668771 TTTCCTGCAGAGAATGGGGATGG + Intronic
1100993684 12:100279149-100279171 GTTTTTCCACAGATGGGGGATGG + Intronic
1102298574 12:111755578-111755600 TTTTTAGTAGAGATGGGGGACGG + Intronic
1102509313 12:113403539-113403561 TTTTTTGTAGAGATTGGGGGGGG + Intronic
1102596187 12:113994199-113994221 TTTTTTGTAGAGATGGGGGGCGG - Intergenic
1102837528 12:116079392-116079414 CCTTTTGCAGAGATGGGGGAGGG + Intronic
1103121798 12:118386565-118386587 TTTTGTGCTAGGATTGGGGAGGG + Intronic
1104849624 12:131865790-131865812 CTTTTTGTAGAGATTGGGGGCGG - Intergenic
1105586584 13:21750711-21750733 TTTTTTGTAGAGACTGGGGTGGG + Intergenic
1106310947 13:28553701-28553723 TATATTGCAAAGTATGGGGATGG - Intergenic
1108354412 13:49617442-49617464 TTTTTTGTAGAGATTGGGGTGGG - Intergenic
1109272563 13:60270874-60270896 CTCTATGTAAAGATTGGGGAAGG - Intergenic
1110407019 13:75162196-75162218 TTTTTTTCAAGGATGCGGGAAGG - Intergenic
1110542760 13:76724286-76724308 TTTTTTTCAAAGAATTGAGAAGG + Intergenic
1110718761 13:78737937-78737959 TTTTTGGCAAAATTTAGGGATGG - Intergenic
1110769946 13:79331020-79331042 TTTTTTGCTAAGATAGGGTCTGG + Intronic
1111717705 13:91900671-91900693 TTTCTTGGTAAGATTGGGGAGGG + Intronic
1111886606 13:94029411-94029433 TTCTTTGCTAAAATTGTGGAGGG + Intronic
1112033907 13:95480380-95480402 TTTTCTGCCAGGATTGGGCAAGG - Intronic
1112797465 13:103072032-103072054 TTTTTTGTAAAGATGGGTGGGGG + Intergenic
1114313027 14:21485088-21485110 TTTTTTGTAGAGATTGGGTCTGG - Intronic
1114514790 14:23291598-23291620 TTTTCTGTAGAGATGGGGGACGG - Intronic
1114819867 14:26005812-26005834 TTTTTTTCAAAAATTTGGGAAGG + Intergenic
1115380747 14:32736114-32736136 TTTTTTGCAATGCTTGTTGAGGG + Intronic
1116091399 14:40311368-40311390 TCTTTAGCAAAGACTGTGGAAGG + Intergenic
1116475761 14:45337039-45337061 TTCTTTTCCAAGATTTGGGAAGG + Intergenic
1116844801 14:49855267-49855289 TTTTTTGTAGAGATTGGTGAGGG - Intergenic
1117415407 14:55490885-55490907 TTTCTTGTAGAGATTGGGGGGGG + Intergenic
1118055176 14:62072414-62072436 TTCATTGCAAAGAATTGGGAAGG + Intronic
1118278806 14:64410394-64410416 TTTTTTGTAAAGATGGGGGGGGG + Intronic
1118744172 14:68762071-68762093 TTTTTTGCCAGGAGAGGGGATGG + Intergenic
1118870839 14:69740021-69740043 TATTTTGCCAAGGTTGAGGACGG + Intronic
1119373444 14:74167706-74167728 TTTTTTATAGAGATGGGGGAGGG + Intronic
1120898956 14:89559200-89559222 TTTTTTGCAGAGATGGGGTTGGG - Intronic
1121013998 14:90537360-90537382 TTTTTTGTAGAGATGGGGGGGGG + Exonic
1121279480 14:92688601-92688623 TTCTTTGCAAAGACCGAGGATGG - Exonic
1122530523 14:102422773-102422795 TTCTTTCCTAAGTTTGGGGATGG + Intronic
1124272798 15:28298477-28298499 TTTTGTGGAATGAATGGGGATGG - Intronic
1124801909 15:32840907-32840929 TATCTTTCAAAGACTGGGGAGGG - Intronic
1125084771 15:35716927-35716949 TTTATTGCACAGGTTGGAGATGG + Intergenic
1125190292 15:36984637-36984659 TTTTTTGCAAAAGTTTGAGAAGG + Intronic
1125499715 15:40232028-40232050 GTTTTTCCACAGATGGGGGATGG + Intergenic
1125960142 15:43823146-43823168 ATTTTTGCAGAGATTGGCGGGGG + Intronic
1126160874 15:45612277-45612299 TTTTTGGCAGAGATGGGGGGGGG - Intronic
1126312251 15:47330754-47330776 TTTTTTGGAAAGATCAGGGACGG + Intronic
1126645078 15:50867745-50867767 TTTTTGGCCAAGAAGGGGGATGG - Intergenic
1127349600 15:58137218-58137240 CTTTTTGCAAAGCTAGGGGAGGG + Intronic
1129143751 15:73628576-73628598 TTTTTTACAACGATTCGGGAAGG - Intronic
1129477177 15:75793331-75793353 TTTTTTGAATAGCTTGGGTAAGG + Intergenic
1129643829 15:77411780-77411802 CTTTTTGTAAAGATGGGGGTTGG + Intronic
1130082807 15:80749280-80749302 TTTTTTGCAAATGTTGTGGAAGG + Intronic
1130404275 15:83583952-83583974 GTTTTTGCATAGTTTGAGGATGG + Intronic
1130630220 15:85560317-85560339 TTTTTTGCAAAGAGTGGGGGTGG + Intronic
1130849087 15:87776543-87776565 TAGTTTGGAAAGACTGGGGATGG - Intergenic
1131846521 15:96495102-96495124 CTATTTACAAAGATTGGGGCAGG + Intergenic
1133218703 16:4308740-4308762 TTTTTTGTAGAGATGGGGCAGGG + Intergenic
1133754550 16:8752585-8752607 TCTTTTGTAGAGATTGGGGTTGG - Intronic
1133818835 16:9218429-9218451 TTTTTTGTAGAGATTGGGGTTGG - Intergenic
1134286639 16:12867688-12867710 TTTTTTGCAGAGATGGGGGGGGG + Intergenic
1134442696 16:14308651-14308673 TTTTTTGCAGAGACTTGGGGGGG + Intergenic
1135004371 16:18805609-18805631 TTTTTTCCAAACGTTGGGGAGGG - Exonic
1135261382 16:20983847-20983869 ATTTTTGTAGAGATAGGGGACGG - Intronic
1135868270 16:26125268-26125290 TTTTTTCCACAGATGGGGGTGGG + Intronic
1136138717 16:28275151-28275173 TTTTTTGTAGAGATGGGGGAGGG - Intergenic
1136927849 16:34390622-34390644 TTTTTTTAAAAGATTAGTGATGG - Intergenic
1136976725 16:35021184-35021206 TTTTTTTAAAAGATTAGTGATGG + Intergenic
1137065683 16:35840504-35840526 TTTTTTGCCAGGTTGGGGGACGG + Intergenic
1138526638 16:57612068-57612090 TTTTTGGTAGAGATTGGGGTGGG + Intronic
1139312238 16:66037399-66037421 ATTTTTGCCAAGATAGGAGAGGG + Intergenic
1139488093 16:67270776-67270798 TTTTCTGCACAGGTTGGGGAGGG - Exonic
1140013624 16:71160964-71160986 ATTTTTCCACAGATTGGGGGTGG + Intronic
1140266190 16:73423163-73423185 TTTTTTGCAGGGGCTGGGGAGGG + Intergenic
1140375528 16:74442657-74442679 TTTTTTGTAGAGATTGGGGGTGG + Intergenic
1140849926 16:78925677-78925699 TCTTTTGCCAAGATTTGAGAAGG + Intronic
1141327741 16:83078322-83078344 ATTTTTCCACATATTGGGGACGG + Intronic
1141539229 16:84706023-84706045 TTTTTTTCAAAGAATGAGTAGGG - Intronic
1142178764 16:88657117-88657139 TTTTTTGTAGAGATGGGGGGGGG + Intronic
1142513986 17:415053-415075 TTTTTTGTAGAGATTGGAGGGGG + Intronic
1142901460 17:3014725-3014747 TTTTTTACAAAAATTAGAGATGG + Intronic
1143051217 17:4127606-4127628 ATTTCTGCCAAGATTGGGAAGGG - Intronic
1143563064 17:7706400-7706422 TTTGCAGCAAAGATTGGGGGAGG - Intronic
1144184152 17:12780730-12780752 TTTTTTGACAAGATTGTGAATGG + Intergenic
1145184656 17:20784056-20784078 TTTTTTGCAGAGATGGGGTCTGG - Intergenic
1145734165 17:27214783-27214805 TTCTTGGCAAATATTGGGTATGG + Intergenic
1146225850 17:31065617-31065639 TTCTTGGCAAATATTGGGTATGG - Intergenic
1146828167 17:36042163-36042185 TTATTTGCAAATATTTGGGGGGG + Intergenic
1147642555 17:42012976-42012998 TTTTTTACAGAGATGGGGGGCGG + Intronic
1147662039 17:42121933-42121955 TTTTTTGTAGAGATTGGTGGGGG - Exonic
1147734701 17:42628385-42628407 TTTTTGGCATAGTTTGGGGAAGG - Intergenic
1147832593 17:43307300-43307322 TTTTTTGTAGAGATGGGGGTTGG - Intergenic
1148399411 17:47341654-47341676 TTTTTTGTAGAGATTGGGCTGGG - Intronic
1148411727 17:47473016-47473038 TTTTTTGCAGAGATGGGGTCTGG + Intergenic
1149140067 17:53421580-53421602 TTTTTTCCACAGACTGGGGGAGG - Intergenic
1149810303 17:59662923-59662945 TTTTTTAAAAAGATAAGGGAGGG + Intronic
1149819093 17:59757677-59757699 TATTTTCCAAAGATTGGTAATGG - Intronic
1150998375 17:70345535-70345557 TTGATTTCAAAGATTGGGCATGG + Intergenic
1151559410 17:74862454-74862476 TTTTTTGGAAGGGTTGGGGTCGG - Intergenic
1151770756 17:76159087-76159109 TTTCTTTCAAGGATAGGGGATGG - Intronic
1151855176 17:76716029-76716051 TTGTTTGCATAGAGTGGGAACGG - Exonic
1152814414 17:82398985-82399007 TTTTTTGTAGAGGTTGGGGCGGG + Intronic
1153086081 18:1289261-1289283 TTTTTTGCAAGGGTGGGGAAGGG - Intergenic
1153121458 18:1732391-1732413 CTATTTGCAAAGATTAGGGTGGG + Intergenic
1153309071 18:3660176-3660198 TTTTTTAAAAGGATTGGGGGTGG + Intronic
1154384158 18:13878680-13878702 TTTTTTGTAAAGATGGGGGGCGG + Intergenic
1155552401 18:26979029-26979051 TTTTTTTTAAAGATTGTGGCAGG + Intronic
1156198206 18:34799936-34799958 TGTTTTGCTAACATTGTGGAGGG + Intronic
1156199900 18:34818812-34818834 TTTTCTGCAGAGGGTGGGGAGGG + Intronic
1157219384 18:45815529-45815551 TTTTTTGCAACCATTGTGAAAGG - Intergenic
1158854832 18:61532432-61532454 TTTTCTGCAGAGATTCAGGATGG - Intronic
1159244595 18:65789490-65789512 TTTTTTGATAAGTTTGAGGATGG + Intronic
1159304499 18:66622580-66622602 TTTTTTACATAGATGTGGGAAGG - Intergenic
1159360519 18:67395871-67395893 TTTTTTGGAAAGATTACGAAGGG - Intergenic
1159397419 18:67879970-67879992 TTTTTTGAAAGGGTTTGGGAAGG + Intergenic
1159556898 18:69955307-69955329 GTTTTTGCATAAACTGGGGAAGG - Intronic
1160274009 18:77413566-77413588 TATTTTACATAGCTTGGGGACGG + Intergenic
1161093043 19:2372503-2372525 TTTTTTCCAAAGACTGGGGGTGG - Intergenic
1161203853 19:3029972-3029994 TTTTTTGCAGAGATGGAGTAGGG + Intronic
1161595035 19:5146760-5146782 TTTTTTGTAGAGATTGTGGGGGG - Intronic
1161638299 19:5403236-5403258 TTTTTTGTAGAGATGGTGGAGGG + Intergenic
1161903654 19:7138552-7138574 TTTTTTGCAGAGATGGGGTCTGG + Intronic
1162239209 19:9335283-9335305 TTTTTGGCAGAGATTGGTGGTGG - Intronic
1162385969 19:10360930-10360952 TTTTTTGTAAAGATAGGGTCTGG + Intronic
1162913021 19:13860030-13860052 TTTTTTGGAGAGATGGGGGTGGG - Intergenic
1163535786 19:17875594-17875616 TTTTTTGTAGAGATGGGGGCGGG - Intronic
1163623003 19:18371941-18371963 TTTTTTGTAGAGATGGGGGGGGG - Intergenic
1164403113 19:27916475-27916497 TCTTTTGCAAAGATGGGGATTGG + Intergenic
1164469904 19:28521544-28521566 TTTTTTACACAGAATGGTGATGG + Intergenic
1164941692 19:32255998-32256020 TTTTTTGTAAAGATGGGGTTGGG - Intergenic
1164957775 19:32401952-32401974 TTTTTTGTAAAGATTGGGGGTGG - Intergenic
1166116839 19:40661531-40661553 TTTTTTGTAGAGATCGGGGTGGG + Intergenic
1166998137 19:46729545-46729567 ACTTGTGCAAAGAATGGGGAAGG + Intronic
1167061527 19:47150668-47150690 TTATGTGCAAAGATTCTGGAAGG - Intronic
1167075658 19:47247235-47247257 TTTTTTGTAGAGATGGGGGGGGG + Intergenic
1167124830 19:47542289-47542311 GTTCTGGCAAAGAGTGGGGATGG + Intronic
1167499229 19:49836100-49836122 TTTTCTTCAAAGGTGGGGGATGG - Intronic
1167585191 19:50370648-50370670 TTTTTTGTAGAGATGGGGGTGGG + Intronic
925424299 2:3735956-3735978 TTTTTTGCAAATCTTGTGGAGGG + Intronic
925609560 2:5692215-5692237 TGCTTTGCAAAGATGGGGGTGGG - Intergenic
926069237 2:9871979-9872001 TTTTTGGCCAAGACTAGGGAGGG + Intronic
926870587 2:17411265-17411287 TTTTTTGAAAAGCATGGGGAAGG + Intergenic
927228063 2:20789876-20789898 ATTTTTCCACAGACTGGGGAGGG - Intronic
927614111 2:24572571-24572593 TTTTTCGTGAAGATTGTGGAAGG + Intronic
928732160 2:34243895-34243917 TTTATTGCAAAGATTGCTGTTGG - Intergenic
929677650 2:43953171-43953193 TCTTCTGCCAAGGTTGGGGAAGG - Intronic
929684599 2:44022974-44022996 ATTTTTGGACAGGTTGGGGAGGG + Intergenic
930065237 2:47322842-47322864 TTTTTTGTAAAGATTGGCGGGGG - Intergenic
930494400 2:52122719-52122741 GTTATTGCAAGGATGGGGGATGG - Intergenic
930717083 2:54603331-54603353 TTTTTTGAAAGGAGTGGTGATGG + Intronic
931421753 2:62134586-62134608 TTTTTTGTAGAGATGGGGGTAGG - Intronic
932245594 2:70193641-70193663 TTTTTTGTAGAGATTGGGGGTGG + Intronic
932302973 2:70680541-70680563 TTTCTTTCAAAAATGGGGGAAGG - Intronic
933477853 2:82815791-82815813 TTTTTTGCAGAGGTTGGTTAAGG - Intergenic
933652403 2:84859936-84859958 TTTTTTGGAGAGATGGGGGGGGG + Intronic
933730603 2:85453316-85453338 TTTTTTGTTGAGATTGGGGGGGG + Intergenic
933765889 2:85709177-85709199 TTTTTTGGAAAGCTGGGTGAAGG + Intergenic
934032058 2:88056638-88056660 TTTTTTATAGAGATTGGGCAGGG + Intergenic
934899399 2:98145893-98145915 ATTTTTGCAGAGATTAGGGTTGG + Intronic
936645333 2:114362914-114362936 TTTTCTGCAAAGCTAGGGTAGGG - Intergenic
936815183 2:116451830-116451852 AGTTTTGCATAGCTTGGGGATGG + Intergenic
936826406 2:116587114-116587136 TTTTTGGAAGAGAGTGGGGAGGG + Intergenic
938815817 2:134903090-134903112 TTATCCCCAAAGATTGGGGAAGG - Intergenic
938963169 2:136361259-136361281 TTTCTTCCACAGATTGTGGAAGG + Intergenic
939902528 2:147867634-147867656 TTTCTAGCAAAGAGTGTGGAAGG - Intronic
940562093 2:155311685-155311707 TTTTTTGCAGGGATTGGCTAAGG - Intergenic
941001933 2:160211020-160211042 TTAGTTGCAAATATTGGGGGAGG + Intronic
941102093 2:161308005-161308027 TTTTTTTAAAAGAGGGGGGATGG - Intergenic
941689499 2:168484489-168484511 TTTTTTCCAAATCTTGAGGAGGG + Intronic
941975355 2:171398484-171398506 TGTTTGGCAGAGGTTGGGGAAGG + Intronic
941996682 2:171607798-171607820 TTTTTTTAAGAGATTGGGGGGGG - Intergenic
942859748 2:180595456-180595478 TTTTTTGTAAAGATGGGGTCTGG + Intergenic
943008456 2:182416442-182416464 TATTTTGAAAAGATTGGGAGAGG - Intronic
943264844 2:185715734-185715756 TATTTTGCTAGCATTGGGGATGG + Intergenic
944489456 2:200243099-200243121 TTTCTTCCAAATATTAGGGAGGG - Intergenic
945285759 2:208079539-208079561 TATTTTGCCAAGGTTGAGGACGG - Intergenic
945438234 2:209844769-209844791 TTTTTTGTAGAGATGGGGGTGGG + Intronic
945893754 2:215459075-215459097 TTTTTTTAAAAGGTTGGGGGGGG + Intergenic
946494050 2:220177706-220177728 TGATTTGAAAAGATTGGTGACGG - Intergenic
946853854 2:223933782-223933804 TTTTTTGTAGAGATGGGGGGGGG - Intronic
947111721 2:226725854-226725876 TTTTTTTCACATATGGGGGATGG + Intergenic
947635295 2:231677622-231677644 TTTTTTGCAGAAATTGCGGGGGG + Intergenic
948636497 2:239341194-239341216 TTTTGTGAAAGGATCGGGGAGGG - Intronic
1169104254 20:2980676-2980698 TTTTTTGTAGAGATGGGGGGAGG - Intronic
1169785649 20:9356936-9356958 TTTTTTGCAGAGATGGGGTCTGG - Intronic
1169926282 20:10787891-10787913 TGTTTTGCAAAGACTTGGGTAGG + Intergenic
1169952799 20:11064674-11064696 AATTTAGCAAGGATTGGGGATGG + Intergenic
1170088662 20:12566210-12566232 TCATTTGCAAATATTGGGGTGGG + Intergenic
1170244824 20:14208904-14208926 TTTATTGGAGAGAGTGGGGAGGG + Intronic
1170537758 20:17358131-17358153 TTTTTTGTAGAGATTAGGGGGGG - Intronic
1170800486 20:19586150-19586172 TGTTTTGGAAAGTCTGGGGAAGG + Intronic
1171381284 20:24736125-24736147 TTTTTTAAAAAGATTGGAGAGGG + Intergenic
1171775175 20:29359382-29359404 TTTTTTCCAAAAATTAGGAAAGG - Intergenic
1172316062 20:33955299-33955321 TCCTTTGCAAAGGCTGGGGAAGG + Intergenic
1172706576 20:36886611-36886633 TTTTTTTTAGAGATAGGGGAGGG + Intronic
1173729733 20:45319873-45319895 TTTTTTGTAGAGATGGGGGAGGG - Intergenic
1174099141 20:48113881-48113903 TTTTAGGAAAAGACTGGGGAGGG - Intergenic
1174346178 20:49931856-49931878 TTTTTTGTAGAGATGGGGGAGGG + Intergenic
1174794803 20:53513073-53513095 TTTTTTGTAGAGATTGGGGGGGG - Intergenic
1174892090 20:54406346-54406368 TTTTTTGTAGAGATTGTGGAGGG - Intergenic
1175440215 20:58985179-58985201 TTATTTGCAAAAATAGGAGAGGG + Intronic
1177131124 21:17256996-17257018 TTTTTTGCACAGAATGGGAGAGG + Intergenic
1177287129 21:19065734-19065756 TTTTGTGACAAGATGGGGGAAGG - Intergenic
1177597562 21:23265661-23265683 ATTTTTCCATGGATTGGGGAGGG - Intergenic
1178034565 21:28564961-28564983 TTTTTTGGAAATATTAGGCATGG - Intergenic
1178183456 21:30191577-30191599 TGTTTTGCCAAGATTAAGGAAGG + Intergenic
1178386975 21:32160423-32160445 TAGTTTGCCAAGATTGAGGATGG + Intergenic
1178415932 21:32405116-32405138 ATTTTTCCAAAGATGGGGGTTGG + Intergenic
1178842847 21:36151747-36151769 TATTTTGCCAAGGTTGAGGATGG - Intergenic
1179239068 21:39572963-39572985 TTTGTTGTCAAGATTGGGCAGGG + Intronic
1179668035 21:42925907-42925929 TATTTTGCCAAGGTTGGGCAGGG - Intergenic
1181415666 22:22756938-22756960 TTTTTTGCACAGAATGTGGAGGG - Intronic
1182280125 22:29213681-29213703 CTTTTTGCAGGGGTTGGGGAAGG + Intronic
1182729233 22:32474305-32474327 TTTTTTGTAGAGATGGGGGGGGG + Intergenic
1183306588 22:37086181-37086203 TTTTTTGCCCAAATTGAGGATGG - Intronic
949107676 3:220137-220159 TTGTTTTTAAAGACTGGGGAGGG + Intronic
949258340 3:2077440-2077462 TTTTTTGCAGAGATGGGGTCTGG - Intergenic
949606171 3:5656738-5656760 TCTCGTGCAAAGATTGGGGAAGG + Intergenic
949775576 3:7629000-7629022 ATTATTGCAAAGTTTGAGGATGG - Intronic
949981400 3:9504020-9504042 TTTTTTTAAGAGATTGGGGGAGG - Intronic
950298895 3:11856881-11856903 TTTTTAGTAGAGATGGGGGATGG + Intergenic
950780421 3:15386967-15386989 TTTTTAGCAGAGATGGGGGGTGG + Intronic
951359119 3:21703504-21703526 TTATTTACAATGATTGGGAAGGG - Intronic
951361425 3:21729125-21729147 TCTTTGGCAAAGATTAAGGAAGG + Intronic
952532346 3:34275444-34275466 TTTTTAGAAAAGAGTAGGGAAGG - Intergenic
952567573 3:34677895-34677917 TTTTTAGTAAATATTGGGGCAGG + Intergenic
953120022 3:40030983-40031005 ATTTTTTCAAAGTCTGGGGAGGG + Intronic
953469020 3:43151068-43151090 TTTTTTGAAATTATTTGGGAAGG - Intergenic
954419768 3:50412602-50412624 TTTTTTGCAGGGGGTGGGGAGGG + Intronic
956091052 3:65667455-65667477 TGTTTTGCACAGACTGGGGAAGG + Intronic
956492847 3:69792578-69792600 TTATTTGCATGGGTTGGGGAAGG - Intronic
957585167 3:82123656-82123678 TTGTTTGCAAAGAAAGGGGAAGG - Intergenic
959125558 3:102286394-102286416 TTTTTTGCAACTATTGTGAAAGG + Intronic
961897442 3:130180312-130180334 TTTTATGGAGACATTGGGGAGGG + Intergenic
962061854 3:131936353-131936375 TTTTTTGCAATGGATGGGGGTGG + Intronic
962607590 3:137045340-137045362 TTTTTTCCCATCATTGGGGAGGG - Intergenic
964547094 3:157846368-157846390 TTTTTTCCAAAGGATGGGGAAGG - Intergenic
965596200 3:170413818-170413840 TTTTTTATAGAGATGGGGGAGGG - Intergenic
965959682 3:174414106-174414128 TTGTTTTCAAATTTTGGGGATGG - Intergenic
966890435 3:184403762-184403784 TTTTTTGTAAAGATGGGGGGGGG + Intronic
967040503 3:185687947-185687969 TTTTGTGCAAAAATTGTGTAAGG - Intronic
967822291 3:193849411-193849433 TATTATCAAAAGATTGGGGACGG + Intergenic
968383050 4:111416-111438 TATTTTGCCAAGGTTGTGGATGG - Intergenic
968618059 4:1590626-1590648 TTTGTTTCAAATATTGGGAACGG - Intergenic
969213851 4:5708179-5708201 TATTTCGCAAAGAATGAGGAAGG - Intronic
970250554 4:14111017-14111039 TTTTATGCAAAGATTGAGGAGGG + Intergenic
971112289 4:23601805-23601827 TTTTTTTCAAAAATTGGGATGGG - Intergenic
971114963 4:23634658-23634680 TTTTTTGGAAAAATTTGAGAAGG + Intergenic
971453097 4:26818404-26818426 TTTTTTGTAGAGATGGGGGTGGG + Intergenic
971458667 4:26870516-26870538 TTTGTTCCAAAGAAGGGGGAAGG - Intronic
972348930 4:38217840-38217862 TTTTTTGCTAAGATTGATGATGG + Intergenic
973105126 4:46326154-46326176 TTTTTACAAAAGAATGGGGAGGG + Intronic
973881761 4:55280110-55280132 TTTTTTGGAAAGGTTTGGGAAGG + Intergenic
974365089 4:60936174-60936196 TTTTTTTTAAAGATTGAGAATGG + Intergenic
974687969 4:65256010-65256032 ATTTGTGAAATGATTGGGGAAGG - Intergenic
975075345 4:70200329-70200351 TTGTTTCCAAAGTTTGGGAAGGG + Intronic
975481003 4:74880307-74880329 TTTTCTCCAAAGAATGGTGAAGG + Intergenic
975977020 4:80110789-80110811 TTTTTTGAAACATTTGGGGAAGG - Intronic
976456748 4:85256699-85256721 TTTTTTCCACAGATTGAAGAGGG + Intergenic
976543879 4:86310296-86310318 TATTTTGCCAAGATTTAGGATGG - Intronic
976583410 4:86767098-86767120 TTTCTTGTAGAGATTGGGGGCGG + Intronic
976670143 4:87643233-87643255 TTTTTTGTAGAGATGGGGGCTGG - Intergenic
977218055 4:94306662-94306684 TTTTCCGCTAAGAATGGGGAAGG - Intronic
977546493 4:98388124-98388146 TTTTTTGAAAAGATTAAGTAGGG - Intronic
977775438 4:100914079-100914101 TTTTTTCCACAGACTGGGGGAGG - Intergenic
978708826 4:111751982-111752004 TTCATTGAAAAGATTGGGAAAGG + Intergenic
978712302 4:111799057-111799079 TTCTATGCACAGAGTGGGGAGGG + Intergenic
978753244 4:112275598-112275620 TTTTCTTCAAAGATTGGCAAAGG - Exonic
979485306 4:121263723-121263745 TTTTTTGCACAGATGGGGCAAGG + Intergenic
980026762 4:127777497-127777519 TTTTTTGCACAAATTGGGGGAGG + Intergenic
980142738 4:128940154-128940176 TTTTTTATAATGAGTGGGGATGG - Intronic
981351587 4:143736054-143736076 TTTTTTGCAGCTATTGTGGAAGG + Intergenic
982909711 4:161124386-161124408 TTTTTTGTAAACATTTTGGATGG + Intergenic
983489403 4:168370406-168370428 ATGGTTACAAAGATTGGGGAGGG + Intronic
983923943 4:173376018-173376040 ATTTTTGCACAGATTGAGGGTGG - Intronic
985221995 4:187716521-187716543 TTTTGTGCTAAGATTTGTGAAGG + Intergenic
985482443 5:123423-123445 TTTTTTGGAAAAATTAGAGAAGG + Intergenic
986967581 5:13293728-13293750 TTTATTACCAAGATTGGGAAGGG - Intergenic
987232916 5:15913805-15913827 AGTTTTGCAAAGCTTGGGAAAGG - Intronic
989091721 5:37740855-37740877 TTCTTTGCCAAGCTAGGGGAGGG + Intronic
989270984 5:39532712-39532734 TTTTCTGATAAGATTGGTGATGG + Intergenic
989320121 5:40124267-40124289 TTTTTTGAAAAGGTTGAGGATGG - Intergenic
990007873 5:50964122-50964144 TCACTTGCAAAGGTTGGGGAGGG + Intergenic
990211032 5:53481446-53481468 TTTTTTGCGAGAATGGGGGATGG - Intronic
992756227 5:79908985-79909007 ATTTTTGTAGAGATTGGGGTGGG + Intergenic
993112757 5:83678952-83678974 TTTCTTGCAAAGATTTGGCAGGG + Intronic
993204119 5:84858240-84858262 TTTTTTGGAAAAATTTGAGAAGG + Intergenic
993469105 5:88285331-88285353 TTTTTTGTACAGATGGGGGGAGG - Intergenic
993562721 5:89431234-89431256 GATTTTGGAAAGAGTGGGGAAGG + Intergenic
994919565 5:106026131-106026153 TTTTTGGAAGAGATTGGGCAGGG + Intergenic
995356826 5:111247545-111247567 TTTTTTTCAAGGAATTGGGAAGG + Intronic
995614989 5:113951868-113951890 TATTTTGCAAAGGGTGGGGGTGG - Intergenic
995630135 5:114123970-114123992 CTTGTTGCAAAAATTTGGGAAGG - Intergenic
995702489 5:114951984-114952006 ATTTTTGAAAAGGTTGGGCATGG - Intergenic
996115900 5:119618104-119618126 TTTTTTTAAAAGATTGAGGTTGG - Intronic
996458970 5:123719383-123719405 TTTTTTCCGCAGATAGGGGAAGG - Intergenic
997669100 5:135655884-135655906 TTTTCTGCAAGGATTTGGGAGGG + Intergenic
998013558 5:138714619-138714641 TTTTTTGAAGAGATGGGGGGGGG + Intronic
998592466 5:143491804-143491826 TTCTTTGCATAGCTTTGGGATGG + Intergenic
998674280 5:144389660-144389682 TTTTTTCCACAGATTGGGCCAGG - Intronic
999075718 5:148793418-148793440 GTTTTTTCAGAGATTGGAGATGG - Intergenic
1000311789 5:160052152-160052174 TTTTTTGGAAAATCTGGGGAAGG - Intronic
1000727755 5:164792855-164792877 TTTTTTGTAGAGGTTGGGGGTGG - Intergenic
1000913448 5:167050400-167050422 TTTTTTTCACAGACTGGGGTTGG - Intergenic
1001644796 5:173272019-173272041 TTTTTTGTAGAGATGGGGGTGGG + Intergenic
1001751018 5:174131558-174131580 TTTTTGGCCAGGGTTGGGGAGGG - Intronic
1003518278 6:6835768-6835790 TTTATTGGAAAGATATGGGAGGG - Intergenic
1003871612 6:10408244-10408266 TTTTCTTAAAAGATGGGGGAGGG + Intronic
1005093245 6:22081328-22081350 TTTTTTGTAGAGACTGGGCATGG - Intergenic
1006468831 6:34214082-34214104 TTTTTTGTAGAGATGGGGGAAGG - Intergenic
1007133552 6:39499334-39499356 TTTTTTTTAAAGAAAGGGGAGGG + Intronic
1007136165 6:39524099-39524121 TTATTTCCAAAGTTTGGGCAAGG + Intronic
1007547703 6:42706988-42707010 TTTTTGGCATGGATGGGGGATGG + Intronic
1007668030 6:43527844-43527866 TTTTATGCAAAAGTTGGGAATGG + Intronic
1007941041 6:45781978-45782000 TTTTTGGCTAAGAAAGGGGAAGG + Intergenic
1008167906 6:48163368-48163390 TTCTTTGCAAAGAGGGTGGAAGG - Intergenic
1008320441 6:50105599-50105621 TTTTATGCAAACACTGGTGAGGG + Intergenic
1008395341 6:51000079-51000101 TTGGGTGAAAAGATTGGGGAGGG - Intergenic
1008650486 6:53556199-53556221 TATTTTGCCAAGGTTGAGGATGG - Intronic
1008726094 6:54421770-54421792 TTTTTTGAAAAAATTTGAGAGGG - Intergenic
1009857497 6:69283363-69283385 TTTTTCTCAAGGATTGGAGAGGG + Intronic
1010050227 6:71495401-71495423 TTGGCTGCAAAGAATGGGGAAGG + Intergenic
1010257778 6:73779005-73779027 TGTTTTGGAAATATTGGTGATGG - Intronic
1010341724 6:74761444-74761466 TTTTTTTCCAAAATTAGGGAAGG - Intergenic
1011239477 6:85255808-85255830 TTACTGGCAAAGAATGGGGAGGG - Intergenic
1012261978 6:97098000-97098022 TTCTTGGCAAACATAGGGGAGGG + Intronic
1012497883 6:99854784-99854806 TTTTTTGCAGAGATGGGGTCTGG + Intergenic
1013465818 6:110416038-110416060 ATTTTTCCACAGACTGGGGATGG + Intergenic
1014758189 6:125325250-125325272 TTCTTTGCAAGTATTGGGGGTGG + Intergenic
1015160973 6:130151855-130151877 TTTTTTGGAAAATTTGGGGAAGG + Intronic
1015875218 6:137815935-137815957 TTTTTTCCATAGCCTGGGGATGG + Intergenic
1016580757 6:145627442-145627464 TTTTTTCCAGAAATTTGGGAAGG - Exonic
1016584791 6:145672618-145672640 TCTTTTGCTAGGACTGGGGAGGG - Intronic
1016776773 6:147913192-147913214 TTTTTTGCACTGATTGTGGTTGG - Intergenic
1017352919 6:153464523-153464545 TTTTTTGCAAAGATTGCACAAGG - Intergenic
1017948786 6:159118172-159118194 ATTTTGGTAAAGATTAGGGATGG - Intergenic
1018144538 6:160871619-160871641 TATTTTGCAAAGATTGCACAAGG + Intergenic
1018464955 6:164035477-164035499 TTTTTTGCAGAGATGGGGGAGGG + Intergenic
1019099981 6:169622324-169622346 TATTTTGCCCAGGTTGGGGATGG - Intronic
1019985119 7:4650072-4650094 ATTTTTGTAGAGATTGGGGTGGG + Intergenic
1021201081 7:17729259-17729281 TTTTTTGTAGAGGTCGGGGAGGG - Intergenic
1021797365 7:24269985-24270007 TTTTTAACAAAGATTGAAGATGG + Intergenic
1022052468 7:26691216-26691238 TTCTTTGCATAATTTGGGGAAGG - Intronic
1023314406 7:38920501-38920523 CTTTTTGATAAGATTGGGCATGG + Intronic
1023317558 7:38955832-38955854 CTTTTTGAAAAGATTTGGGTTGG - Intergenic
1023327183 7:39073169-39073191 TAGTTTGCATGGATTGGGGATGG - Intronic
1025978794 7:66391017-66391039 TTTTTTCCACAGACTGGGGGTGG + Intronic
1026191607 7:68133580-68133602 TTTTTTGTAGAGATGGGGGGGGG - Intergenic
1026398727 7:69986880-69986902 TTTTTATGAAAGATTGGGCAAGG - Intronic
1026920384 7:74151212-74151234 TTTTCTGTAGAGATGGGGGATGG - Intergenic
1026927328 7:74203648-74203670 TTTTTTGCAGAGATAGGGAGGGG - Intronic
1027247851 7:76379563-76379585 TTTTTTGTAGAGATTGGGCGAGG + Intergenic
1027613554 7:80392804-80392826 TTTTTTCCACGGATTGGGGTGGG + Intronic
1027751467 7:82152622-82152644 ATTGTTGCAGAAATTGGGGAGGG + Intronic
1028479812 7:91292460-91292482 ATTTTTCCACAGATTGGGGTAGG - Intergenic
1029140085 7:98403009-98403031 TTTTTTGCAGAGATGGGGGTGGG - Intergenic
1029529976 7:101118869-101118891 TTTTTTGTAGAGGTTGGGGGGGG + Intergenic
1030051949 7:105545979-105546001 TTTTTAGTAGAGATGGGGGATGG + Intronic
1030272197 7:107681933-107681955 TTTTTTGTAGAGATTGGGGCGGG - Intronic
1030641618 7:112012642-112012664 TTTTTTCCAAATATTGGTGGTGG - Intronic
1031229081 7:119082391-119082413 TTGTTGGCAAAAAATGGGGAAGG + Intergenic
1031351288 7:120734583-120734605 ATTTTGACAAAGATTGGGGAAGG - Intronic
1032062631 7:128737716-128737738 TTTTTTGTAGAGATAGGGGGAGG + Intergenic
1032472291 7:132187371-132187393 TTTATTGCAGAGAGTTGGGAGGG - Intronic
1032905844 7:136364671-136364693 TTATTTGCAAACATAGGGGAAGG + Intergenic
1032964667 7:137082038-137082060 TTTTCTGCAAAGTTTGAGGCTGG - Intergenic
1033091785 7:138393015-138393037 TGTTTGCCAAAGACTGGGGAAGG + Intergenic
1033629457 7:143142329-143142351 CTTTTTGTAGAGATTGGGCAGGG + Intergenic
1033876746 7:145829396-145829418 TTTTTTGTTGAGATTGTGGAGGG - Intergenic
1035980788 8:4368977-4368999 TTTTCTGCTATGTTTGGGGATGG + Intronic
1036578596 8:10052378-10052400 TTTTTTCCACAGATGGGGAAGGG - Intergenic
1036731412 8:11268918-11268940 TTTTATGCAAAGAATGGGCGGGG + Intergenic
1036736953 8:11328167-11328189 TTTTTTTCAAATATTGGTGAAGG + Intergenic
1037928010 8:22859844-22859866 TTTTTTAAAAAGATTGGGAAGGG - Intronic
1038112424 8:24514107-24514129 CTTTTGGCTAGGATTGGGGAGGG - Intronic
1038514415 8:28173176-28173198 TTTTTTGCAAGTATTTGAGAAGG + Intronic
1038719469 8:30021065-30021087 TTTTTTCCAAAGACTGTGGAAGG + Intergenic
1039144135 8:34426564-34426586 TATTTTGAAAAGAGTGGAGAAGG - Intergenic
1039873763 8:41568192-41568214 TGTATTGCAGAGGTTGGGGAGGG + Intergenic
1040847992 8:51865270-51865292 TTTTTTGGAAGGATTTGAGAAGG - Intronic
1041646640 8:60259749-60259771 TTTTTTGCCAAGATGTGAGAGGG + Intronic
1041835661 8:62210428-62210450 ATTTTTCCACAGAGTGGGGATGG - Intergenic
1042188534 8:66161766-66161788 TTTTTTGCAAGTATTGTGAAAGG + Intronic
1042467443 8:69144123-69144145 TCTTTTGCTAAGATGGGGAAAGG - Intergenic
1043237755 8:77890289-77890311 TTTTTTTTTTAGATTGGGGATGG - Intergenic
1043287023 8:78545212-78545234 TTTTCTCCAAAGACTGGGGTTGG - Intronic
1044315828 8:90749496-90749518 TTTTTTGGGTAGGTTGGGGATGG + Intronic
1044624197 8:94220166-94220188 GTTTCTCCTAAGATTGGGGAAGG + Intergenic
1044715352 8:95094928-95094950 TTTTTTGCAGAGTTTGGGGGTGG + Intronic
1045540937 8:103084528-103084550 TTTTTTGTAAAGATGGGGTCTGG - Intergenic
1045543607 8:103108949-103108971 ATCTTTTCAGAGATTGGGGATGG - Intergenic
1045773184 8:105769517-105769539 TATTTTGGAAAGATGGGAGAGGG + Intronic
1045773520 8:105774116-105774138 TTTTCTGCATAGATTATGGAAGG - Intronic
1045910804 8:107407465-107407487 TGTTTTCAAAAGAATGGGGATGG + Intronic
1046383821 8:113483810-113483832 TCTTTTCCAGAGAGTGGGGAAGG - Intergenic
1047513900 8:125536923-125536945 ATTTTTCCATGGATTGGGGAAGG + Intergenic
1047594488 8:126364672-126364694 TTTTTTGCAGGGACTGGGGAGGG - Intergenic
1047718162 8:127614870-127614892 TTTTTTGAACAGATTGAGCAAGG + Intergenic
1048752306 8:137693137-137693159 ATTCTAGCAAAGCTTGGGGAAGG - Intergenic
1049950850 9:642295-642317 TGTTTTACAAAGATAGCGGAAGG + Intronic
1050698357 9:8305432-8305454 TTTTTTGAAAATATTTGAGAAGG + Intergenic
1051387263 9:16522547-16522569 TTTTTTACAGGGATGGGGGAGGG + Intronic
1051446653 9:17147134-17147156 CTTTTTGTAAGGCTTGGGGAAGG + Intronic
1051601017 9:18874042-18874064 TTTTTTGCAACTATTGTGAAAGG + Intronic
1052128797 9:24814699-24814721 TTTATTGCAATGGCTGGGGATGG + Intergenic
1052482667 9:29051304-29051326 TTGTTACCAAAGGTTGGGGAGGG - Intergenic
1052795648 9:32921229-32921251 TTTTTTAAAAAAATTGGGGCTGG - Intergenic
1053165703 9:35842287-35842309 GATTTCGCAAAGAGTGGGGAAGG - Intronic
1055768153 9:79687436-79687458 TTTTCTGAAAAGATTAGAGAAGG - Intronic
1056312945 9:85359373-85359395 TTTTTTTCCAAGATGGTGGACGG - Intergenic
1056539752 9:87561207-87561229 TTTGTAGCAATGATTGGGGAGGG - Intronic
1057454287 9:95193515-95193537 TATTTTGTGAACATTGGGGAGGG + Intronic
1058636198 9:107040949-107040971 TTTTTTAAAAAGAAAGGGGATGG - Intergenic
1059084455 9:111285000-111285022 TTTCTTGTGAAGATGGGGGAAGG - Intergenic
1061467589 9:130794143-130794165 ATTTTTCCACAGACTGGGGATGG - Intronic
1061494546 9:130964504-130964526 ATTTTTGTAGAGATTGGGGTGGG + Intergenic
1061675820 9:132215063-132215085 TTTTTTGTAGAGATTGGGGGGGG + Intronic
1061692433 9:132344387-132344409 TTTTTTGTAGAGATGGGGGAGGG + Intronic
1061723612 9:132569227-132569249 TTTTTTGTAGAGATGGGGGGAGG - Intronic
1185789014 X:2914405-2914427 TTTTTTGTAGAGATGGGGGGGGG + Intronic
1185818157 X:3175711-3175733 TTTTTTGTAGAGATTGGGTGGGG + Intergenic
1186173510 X:6902050-6902072 TTTTTTGTAAAGATGGCGGGGGG + Intergenic
1186519522 X:10193114-10193136 TTTGCTACAAAGATTTGGGAGGG + Intronic
1186560022 X:10601761-10601783 TTTTTTCCAATTATTGGGAATGG + Intronic
1188025120 X:25200188-25200210 TTTTTTGACAAGACTGAGGATGG + Intergenic
1189343139 X:40219778-40219800 TTTTTTGTAGAGATGGGGGAGGG + Intergenic
1189368331 X:40407372-40407394 TTTTTTGTAGAGATCGGGGCTGG + Intergenic
1189787702 X:44573975-44573997 TTTTTGGTAGAGATTGGGGGTGG + Intergenic
1189989217 X:46578581-46578603 TTTTTTGCAAAGATTGGGGATGG + Intronic
1190951561 X:55150285-55150307 ATTTTTCCACAGATGGGGGAAGG + Intronic
1191025315 X:55907920-55907942 TTTTTTGACTAGAATGGGGAAGG - Intergenic
1191860969 X:65666629-65666651 TTTTTTGTATAGATATGGGAGGG + Intronic
1192477232 X:71453392-71453414 TTGTTTGTAGAGATTGGGGGTGG - Intronic
1193260564 X:79402315-79402337 ATTTTTTGAAAGATTGAGGAGGG - Intergenic
1193380017 X:80808259-80808281 TATGTTACAAACATTGGGGAAGG - Intronic
1194497916 X:94639785-94639807 TTTTTTTAAAAGATGGGAGAAGG + Intergenic
1194864227 X:99046447-99046469 TTATTTGTAAAAATTGTGGATGG + Intergenic
1195451606 X:105020149-105020171 TTTTTTGTAGAGATTGGTGGGGG + Intronic
1195499654 X:105580375-105580397 TTTTTTGCATACTTTGGTGAAGG + Intronic
1195772298 X:108364253-108364275 TTTCTTGAATAGATTGTGGAAGG - Intronic
1195972408 X:110487596-110487618 CTTTTTGCAACTATTGGGAAAGG + Intergenic
1195984828 X:110617786-110617808 TTTTTTGCAGCTATTGGGAAAGG + Intergenic
1196084027 X:111664703-111664725 TTTTTTGTAGAGATGGGGGGGGG - Intergenic
1196293924 X:113977736-113977758 TATTTTGCCAAGGTTGAGGATGG - Intergenic
1197671940 X:129286511-129286533 TTTTTTGCAGAGAGTAGGGATGG + Intergenic
1198050631 X:132949816-132949838 TTTTATGCTTAGATTTGGGAGGG + Intronic
1198106525 X:133467239-133467261 TTTTTTGCAACTATTGTGAACGG + Intergenic
1199387093 X:147235795-147235817 ATTTTTGCCAAGATTTGGAACGG + Intergenic
1199734171 X:150668514-150668536 TTTTTTGTAGAGATGGAGGAGGG - Intronic
1200087958 X:153619317-153619339 TTTTTTGTACAGATTGGGGGGGG + Intergenic
1200159217 X:153996479-153996501 TGTTTTGCCAAGGTTGAGGATGG - Intergenic
1200717174 Y:6561286-6561308 TTTTTTGCAACGATTGTAAAAGG + Intergenic
1201262525 Y:12174146-12174168 TTTTTTGTAGAGATTGGTGAGGG - Intergenic
1201332262 Y:12837291-12837313 TTTTTTTCACAGACTGAGGATGG + Intronic