ID: 1189990555

View in Genome Browser
Species Human (GRCh38)
Location X:46589911-46589933
Sequence GAACTATTGCTGGCTGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 102}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189990555 Original CRISPR GAACTATTGCTGGCTGCTGC TGG (reversed) Intronic
900478890 1:2888849-2888871 GAAATATTTCTGCCCGCTGCTGG - Intergenic
900737940 1:4310846-4310868 GTGATATTGCTGGCTGCTGTGGG + Intergenic
910701137 1:90075402-90075424 GAAATATCGTTGGCAGCTGCTGG - Intergenic
910740523 1:90510716-90510738 TAAATATTGCTATCTGCTGCTGG + Intergenic
915470477 1:156122973-156122995 GAATTATTCCTGGCTTCAGCAGG - Intronic
923451936 1:234126135-234126157 GAACTATTGTTTTCTGTTGCTGG + Intronic
923747532 1:236716390-236716412 GAAATGTTTCTGGCAGCTGCTGG - Intronic
924244204 1:242065871-242065893 GAACTCTTGCACGCTGCTGGTGG - Intergenic
924635522 1:245784157-245784179 GAACTAGTGCTTGCTACTTCTGG - Intronic
1063287709 10:4708548-4708570 GCACTGTGGATGGCTGCTGCTGG - Intergenic
1067767669 10:49099292-49099314 TAAGCATTGCTGGATGCTGCTGG - Intronic
1068711044 10:60134083-60134105 GAAATATTCCTGTCTTCTGCAGG - Intronic
1069792410 10:71031316-71031338 GAGCTGGTGCTGGCTGCTGTAGG - Intergenic
1071991446 10:91104222-91104244 GAAGTGTGGGTGGCTGCTGCTGG - Intergenic
1078454317 11:11463253-11463275 GAGCTTTTGTAGGCTGCTGCGGG - Intronic
1084279923 11:68081613-68081635 GTACTAGTGCTGGAGGCTGCTGG - Intronic
1088797940 11:113279853-113279875 GAAGCATTGCTGATTGCTGCAGG - Intergenic
1093726351 12:22514958-22514980 GAGCTGTTCCTGGCTGCTTCTGG - Intronic
1101585629 12:106083097-106083119 GTATTATTGCTGGCTGCTGCTGG - Intronic
1102368693 12:112362598-112362620 CTACTAATACTGGCTGCTGCTGG + Intronic
1109430723 13:62230430-62230452 GACCTCTTGCTGGCTTCTTCAGG - Intergenic
1112249801 13:97769366-97769388 CAACTATTGGTCACTGCTGCTGG + Intergenic
1115825166 14:37263228-37263250 GAATTATTGCTTGCTTCTGGAGG - Intronic
1115885730 14:37969724-37969746 GAAATATTGATGGCTGAGGCAGG + Intronic
1118775075 14:68968852-68968874 GTACCAGGGCTGGCTGCTGCTGG + Intronic
1123431054 15:20216718-20216740 GCACTAATTCTAGCTGCTGCAGG - Intergenic
1124049123 15:26178771-26178793 GAACGGCTGCTGGCTGCTTCTGG + Intergenic
1133487520 16:6234475-6234497 AAACTATTTCTGAATGCTGCTGG - Intronic
1135922716 16:26665440-26665462 GAACTCAGGCTGGCTGCTGCTGG + Intergenic
1136853597 16:33634529-33634551 GCACTAATTCTAGCTGCTGCAGG + Intergenic
1138917271 16:61481500-61481522 GACCTATGTCAGGCTGCTGCTGG + Intergenic
1140649360 16:77069934-77069956 GTCCTCTTGCTGGCTGGTGCTGG + Intergenic
1203115190 16_KI270728v1_random:1482974-1482996 GCACTAATTCTAGCTGCTGCAGG + Intergenic
1143118832 17:4595181-4595203 GAGTTATGGCTGGCGGCTGCGGG - Exonic
1146783298 17:35695715-35695737 AAATTATTGCTGGCTGTTTCTGG - Intronic
1147951218 17:44109118-44109140 GGCCAACTGCTGGCTGCTGCTGG + Intronic
1149681035 17:58507271-58507293 GATCTCTGGCTGGCTGCAGCGGG + Exonic
1151955073 17:77376153-77376175 CCACTGCTGCTGGCTGCTGCTGG - Intronic
1152699411 17:81811704-81811726 CAACTACTGCTGGCTGCTGGTGG + Exonic
1203171251 17_GL000205v2_random:149313-149335 GCAGTAATGCTGCCTGCTGCTGG + Intergenic
1155522257 18:26680331-26680353 CAACTAAGGCTGACTGCTGCTGG + Intergenic
1157383833 18:47246720-47246742 GAACTCCTCCAGGCTGCTGCAGG - Intronic
1162006640 19:7785026-7785048 GAACTGTTGCTCACTGCTGGTGG - Intergenic
1164945844 19:32292433-32292455 GACAGATTTCTGGCTGCTGCAGG - Intergenic
1166738904 19:45102481-45102503 GAACAGTAGCTGGCTGTTGCAGG + Intronic
925744542 2:7033124-7033146 GGACTCTGGCTGGCTGTTGCTGG + Intronic
926582503 2:14646647-14646669 CAACTATTGCAGGTTGTTGCTGG - Intronic
930680671 2:54254385-54254407 CACCTATTGCTGCCTGCTACTGG - Exonic
931213106 2:60215834-60215856 GAACTATTGCGGGCAGCCGCGGG + Intergenic
932229779 2:70073698-70073720 AAAGCATTGCTGGCTGTTGCTGG + Intergenic
936758530 2:115744704-115744726 GAACTCCTGCTGGCTACTGTTGG + Intronic
937124031 2:119461931-119461953 CAACTACTCCTGGCTGCTGGTGG - Exonic
938365346 2:130729236-130729258 GAAGTGTTGCTGGCTGCTTGGGG - Exonic
939112606 2:138026771-138026793 GAACTATTGCTTGCCGTTGAGGG + Intergenic
941003046 2:160221424-160221446 GAGAGATGGCTGGCTGCTGCTGG + Intronic
941279888 2:163536810-163536832 GAAGTGTAGCTGGCTGCTTCTGG - Intergenic
946184950 2:217975439-217975461 GAACTATCGCTTCGTGCTGCAGG + Intronic
947023217 2:225707237-225707259 TAACTATTGCTGCCTTCTGGAGG + Intergenic
948236498 2:236394800-236394822 GAGCTCTTGCTGGGTCCTGCTGG - Intronic
948767347 2:240230017-240230039 GAAGTATCGGTGGCAGCTGCAGG + Intergenic
1170449680 20:16469702-16469724 GAACTCTTGCTCACTGCTGGTGG + Intronic
1176982084 21:15394166-15394188 GAACTCTCGTTGGCTGCTGGTGG + Intergenic
1178009536 21:28267719-28267741 GAACTATTGCTGCATACAGCTGG + Intergenic
1180877282 22:19180474-19180496 GAACTACTGCTGTGTCCTGCTGG - Intronic
1182078279 22:27510230-27510252 GAACTATTGCTCGCACCTGTTGG - Intergenic
1183744907 22:39686467-39686489 GAAGTATTGCTGTCTGCTCCTGG - Exonic
1184904968 22:47476233-47476255 GAAGTATTGCTATATGCTGCAGG - Intronic
955583240 3:60447740-60447762 GAATTATTACTGGCAGCTGCAGG - Intronic
956752599 3:72355180-72355202 GGAATATTCCTGGCTGCAGCTGG + Intergenic
961534757 3:127563609-127563631 AAACTATGACTGGCTGCTGGTGG + Intergenic
967847057 3:194052419-194052441 GAGCTAATGCTGGCAGCTGTTGG - Intergenic
974629035 4:64458744-64458766 TAAGTATTGCTGGCTCCTGCTGG - Intergenic
975023682 4:69521689-69521711 TAACTATTGCTTGCACCTGCTGG - Intronic
980703005 4:136457145-136457167 GAAGTATTGATGGCTGCAGTGGG + Intergenic
983584552 4:169341238-169341260 GAACAAATTGTGGCTGCTGCTGG - Intergenic
989217108 5:38916960-38916982 GAAGAAATGCTGGGTGCTGCAGG + Intronic
990522264 5:56591641-56591663 GACTTTTTGCTGGCTGCTGCAGG - Intronic
991011190 5:61884531-61884553 AAAAGACTGCTGGCTGCTGCTGG + Intergenic
991048283 5:62245653-62245675 GCACTAATTCTAGCTGCTGCAGG - Intergenic
992011283 5:72530246-72530268 TAACTATTGCTGGCTGCTTCTGG + Intergenic
992212423 5:74493893-74493915 GAGATATTGCTGGTTGCTGTGGG - Intergenic
993530913 5:89024494-89024516 TAACTAGTGCTGTCAGCTGCTGG - Intergenic
995595383 5:113742487-113742509 GAACAAATGCTGGATGCTGTGGG - Intergenic
999111078 5:149121820-149121842 GCTCTCTTGCTGTCTGCTGCAGG - Intergenic
1002107334 5:176886695-176886717 GAACAAATGCTGGTTCCTGCAGG + Intronic
1002157067 5:177291137-177291159 GAACATCTGCTGGCTGCTCCAGG + Intronic
1002198696 5:177514780-177514802 GTACTACTGCCGCCTGCTGCAGG - Exonic
1003139513 6:3458352-3458374 GAACTATTTCTGAAGGCTGCCGG + Intergenic
1007809876 6:44478172-44478194 GAACTATTGCTGGAGGCTTCTGG - Intergenic
1011640126 6:89410975-89410997 GAACTTTTGCTCGCTTCTGAGGG + Intronic
1012304373 6:97633283-97633305 AATCTATTGCTTGCTACTGCAGG + Intergenic
1015140855 6:129929967-129929989 GATCTATTGGTGGCTGCTGCTGG + Intergenic
1016504552 6:144764271-144764293 GACGGTTTGCTGGCTGCTGCAGG - Intronic
1017045226 6:150340988-150341010 GAACTATTGCTCAATTCTGCAGG + Intergenic
1018411565 6:163554132-163554154 GAACCCTAGCTGGCTGCTTCTGG + Intronic
1018980411 6:168597774-168597796 GACCTGTTGTTGGCTGCAGCAGG - Intronic
1022550768 7:31237102-31237124 GAGCTGTTGCTGGCTGCCACTGG + Intergenic
1027445989 7:78274330-78274352 GAGCTATGGCTGGCATCTGCAGG - Intronic
1032148021 7:129401468-129401490 CAACCATTGCTTGCTGCTGAAGG + Intronic
1039234139 8:35483312-35483334 GAACTAGTGCTGTCTACTGATGG + Intronic
1041171824 8:55150324-55150346 GATTTATTGCAGGCTGATGCTGG + Intronic
1042070727 8:64930812-64930834 GAGCTCTTGCTGGCATCTGCTGG - Intergenic
1046549174 8:115691281-115691303 GAACAATTGGTGGATGTTGCAGG - Intronic
1047789559 8:128189014-128189036 GAACTATAGGTGTATGCTGCTGG + Intergenic
1050362575 9:4844645-4844667 GAACTGTGCCCGGCTGCTGCTGG + Exonic
1053115873 9:35501692-35501714 GAACCATGGTTGGCTGCTACTGG - Intronic
1055565351 9:77562945-77562967 GATCTAATGCTGGCTGGGGCTGG - Intronic
1056558127 9:87706686-87706708 GATCAAGTGCTGCCTGCTGCTGG + Exonic
1059360245 9:113736520-113736542 GACATTTTGCTAGCTGCTGCTGG - Intergenic
1059930596 9:119256591-119256613 GAACAATTGTTAGCTGCTGTTGG + Intronic
1060959240 9:127667652-127667674 GGCCTATTGCAGGCAGCTGCTGG + Intronic
1189990555 X:46589911-46589933 GAACTATTGCTGGCTGCTGCTGG - Intronic
1193311451 X:80015168-80015190 GGACTATTGCTGGCTTCTTTGGG - Intronic
1193658455 X:84226303-84226325 GAAGCAGTGCTGCCTGCTGCTGG - Intergenic
1200121375 X:153792559-153792581 GAACTACTGCTGGGAGCTGCAGG - Intronic