ID: 1189992642

View in Genome Browser
Species Human (GRCh38)
Location X:46609269-46609291
Sequence CACTCTTTGCAGAGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 227}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189992635_1189992642 21 Left 1189992635 X:46609225-46609247 CCACAGAGGAAACCCTGGGCATG 0: 1
1: 0
2: 0
3: 26
4: 377
Right 1189992642 X:46609269-46609291 CACTCTTTGCAGAGGGAAGCAGG 0: 1
1: 0
2: 2
3: 15
4: 227
1189992636_1189992642 9 Left 1189992636 X:46609237-46609259 CCCTGGGCATGAACTGTGATGTG 0: 1
1: 0
2: 0
3: 10
4: 145
Right 1189992642 X:46609269-46609291 CACTCTTTGCAGAGGGAAGCAGG 0: 1
1: 0
2: 2
3: 15
4: 227
1189992637_1189992642 8 Left 1189992637 X:46609238-46609260 CCTGGGCATGAACTGTGATGTGG 0: 1
1: 0
2: 2
3: 19
4: 183
Right 1189992642 X:46609269-46609291 CACTCTTTGCAGAGGGAAGCAGG 0: 1
1: 0
2: 2
3: 15
4: 227
1189992632_1189992642 29 Left 1189992632 X:46609217-46609239 CCACAGCACCACAGAGGAAACCC 0: 1
1: 0
2: 1
3: 33
4: 379
Right 1189992642 X:46609269-46609291 CACTCTTTGCAGAGGGAAGCAGG 0: 1
1: 0
2: 2
3: 15
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189992642 Original CRISPR CACTCTTTGCAGAGGGAAGC AGG Intronic
901263626 1:7892390-7892412 CAAGCTTTGCAGATGGAGGCAGG - Intergenic
901818194 1:11806745-11806767 GATGCTTTGCAGGGGGAAGCTGG - Intronic
902112964 1:14098600-14098622 CAGTCTGGGCAGAGGGATGCTGG - Intergenic
902639583 1:17758248-17758270 CACACATTGGAGAGGGTAGCAGG + Intronic
903250322 1:22048624-22048646 CTCTGCTTGCAGTGGGAAGCTGG + Intergenic
903779380 1:25811583-25811605 CACTCATTGCAGAGGGAGGGCGG - Intronic
904026099 1:27504693-27504715 CATTCTCACCAGAGGGAAGCAGG - Intergenic
906201577 1:43963856-43963878 CAGTCATTGAAGAGGAAAGCTGG - Intronic
906789748 1:48648444-48648466 CTCTCTTGGAAGAGGGAAGTGGG - Intronic
907328276 1:53654903-53654925 CAGTCTCTGAAGAGGGAAGTGGG + Intronic
907974379 1:59416848-59416870 CACTCTTAGCAGCAAGAAGCAGG + Intronic
914904770 1:151734834-151734856 CAGTCGTTGGAGGGGGAAGCAGG + Intergenic
914978398 1:152389122-152389144 CACTCTTTGCAGTGGGGTGGTGG - Intergenic
915244668 1:154547859-154547881 CTCTCTTTTGAGAGGGAAGCTGG - Exonic
915819739 1:159009481-159009503 CACTCTGTGCACAGGAAAGGAGG + Intronic
916992519 1:170259580-170259602 CCCTCTTTGTAGACGGATGCAGG - Intergenic
920764009 1:208813585-208813607 CTCTCTGTGCAGTGGGCAGCAGG - Intergenic
923546764 1:234928970-234928992 CACTCTTTGGTAGGGGAAGCAGG + Intergenic
924428348 1:243974429-243974451 CTCGCTTTGGAGAGGGAAGGAGG + Intergenic
1065256045 10:23869237-23869259 GACTCTTTCCAGTGGGAAGATGG + Intronic
1065971365 10:30808545-30808567 CGCACTGTGCAGAAGGAAGCAGG + Intergenic
1067934051 10:50593062-50593084 CTCTGTTTTCGGAGGGAAGCTGG + Intronic
1069936282 10:71919460-71919482 CACTCTTTGCTGAGGGCTGTTGG - Intergenic
1070150818 10:73803806-73803828 AAGTCTGTGCTGAGGGAAGCTGG + Intronic
1071318046 10:84422132-84422154 CTCACTTTGCAGAAGGAAGAAGG + Intronic
1072444844 10:95489969-95489991 TACTCTTTGTAGAGAAAAGCTGG - Intronic
1075073702 10:119336264-119336286 CACAGTTTGCCCAGGGAAGCTGG + Intronic
1075714834 10:124550174-124550196 CACTCCTTGCCGAGGGAGCCTGG + Intronic
1076494836 10:130890155-130890177 CCCTCTCTGCCTAGGGAAGCCGG + Intergenic
1078355850 11:10630859-10630881 CACTCTTGGCACAGGGGAGGGGG - Intronic
1079134713 11:17769997-17770019 CATTCTGTGTTGAGGGAAGCTGG - Intronic
1079138523 11:17792098-17792120 CACTCTATCAAGAGGGTAGCTGG + Intronic
1080041356 11:27762776-27762798 CACTCTTTGCGTTTGGAAGCTGG + Intergenic
1081220565 11:40455276-40455298 CACTAGTTCCAGATGGAAGCAGG + Intronic
1083202884 11:61131081-61131103 CCCTCTGGCCAGAGGGAAGCGGG - Exonic
1083751737 11:64764750-64764772 CACTTCATGGAGAGGGAAGCGGG + Exonic
1084225973 11:67715080-67715102 CCCTGTTTGCAGAAGGCAGCGGG - Intergenic
1084263804 11:67994954-67994976 CCCTGTTTGCAGAAGGCAGCGGG - Intronic
1084409220 11:68996855-68996877 CCCTCTGAGCAGTGGGAAGCCGG + Intergenic
1084551456 11:69845566-69845588 CAGTCCATGCAGAGGGAAGAAGG + Intergenic
1084712386 11:70852057-70852079 CACTCTGTGCCCAGGGAAGCAGG + Intronic
1084809605 11:71604164-71604186 CCCTCTTTGCAGAAGGCAGCGGG + Intergenic
1085153004 11:74267226-74267248 AACTGTTGGCAGAGAGAAGCTGG - Exonic
1088926162 11:114305311-114305333 CACTCTCTACAGAGGCAACCAGG - Intronic
1089360391 11:117882157-117882179 CATTCTATGAAGAGGGATGCCGG - Intergenic
1091184565 11:133636121-133636143 CTGACTTTGCAGAGTGAAGCTGG - Intergenic
1092710276 12:11329185-11329207 CACTAATTGCACAGGGAAACTGG + Intergenic
1093867360 12:24244558-24244580 CACAGTTGGCAGAGGGAAACCGG - Intergenic
1096002399 12:48140703-48140725 CACTCTATACAGGAGGAAGCAGG - Exonic
1097643539 12:62209343-62209365 CACTCTTTTCACAAGGCAGCAGG - Intronic
1100107486 12:91193668-91193690 CAGGCTATGCAGAGGGAAGTGGG - Intergenic
1101407676 12:104443065-104443087 CATTCTTGTAAGAGGGAAGCAGG + Intergenic
1101457213 12:104846738-104846760 CACACTTAGCACAGGGTAGCCGG + Intronic
1102986520 12:117282943-117282965 TACACTGTGCTGAGGGAAGCAGG - Intronic
1103050958 12:117779060-117779082 CTGTCTTTGCAGAGGGAAATTGG - Intronic
1103208858 12:119152147-119152169 TTCTTTTTGCAGAGGAAAGCTGG - Intronic
1104265840 12:127231812-127231834 CACTCTCTGCAGGTGGAACCTGG - Intergenic
1104339026 12:127930045-127930067 CTCTCAGTGGAGAGGGAAGCTGG - Intergenic
1105024993 12:132842250-132842272 CAGTCTGTGGAGAGGGAAGGTGG - Intronic
1105553453 13:21421059-21421081 ACCTCTTTGGAGGGGGAAGCGGG + Exonic
1106865187 13:33956678-33956700 CACTCTTAGCTGTGTGAAGCTGG + Intronic
1107076255 13:36324145-36324167 CATTCTTCCCAGAGGGAAGTGGG + Intronic
1109915988 13:68985285-68985307 AATTCTTTGGAGGGGGAAGCAGG - Intergenic
1110803129 13:79723666-79723688 CCCTTCTGGCAGAGGGAAGCTGG + Intergenic
1111201909 13:84949071-84949093 CTTTCTTTGCAGAGAGCAGCAGG + Intergenic
1112470694 13:99685997-99686019 CACTCTTATCACAGGGACGCAGG - Intronic
1115766160 14:36625540-36625562 CTCTGTTTGGAGAAGGAAGCCGG - Intergenic
1118240035 14:64047168-64047190 CTCTCAGTGGAGAGGGAAGCTGG + Intronic
1118921098 14:70150676-70150698 CTCTCTTTGCAGAGGAAAGCAGG + Intronic
1119024193 14:71139660-71139682 CCCTCTGTGCGGATGGAAGCAGG - Intergenic
1119050100 14:71358774-71358796 TAGTCATGGCAGAGGGAAGCAGG + Intronic
1119415739 14:74468051-74468073 CTCCCTGTGCAGAGGGAAGCTGG + Intergenic
1119653615 14:76400859-76400881 TGCTCTGTGCAGAGGGCAGCTGG + Intronic
1121664344 14:95660542-95660564 CTCTTTTTGCTGAGGGAAGTGGG - Intergenic
1122297620 14:100714136-100714158 CTGTGGTTGCAGAGGGAAGCCGG - Intergenic
1122985068 14:105208207-105208229 CACCCTTTGGGGATGGAAGCGGG - Intergenic
1124105811 15:26736916-26736938 CACTCTTTGCAGACCTAACCTGG - Intronic
1124208405 15:27742601-27742623 CACTGTCTGCAGAAGCAAGCTGG + Intergenic
1124392475 15:29272137-29272159 CACTCTTTCCAGAAGAATGCAGG + Intronic
1125102311 15:35928629-35928651 CAGTCTCTGCAGTGAGAAGCAGG + Intergenic
1126196895 15:45941736-45941758 GACTCTTTGGAGAGAGCAGCAGG + Intergenic
1126330158 15:47523089-47523111 CACTGTTAGCAGATGGAAGATGG - Intronic
1126367295 15:47908304-47908326 CTGCCTTTGCAGAGGGAAGCTGG + Intergenic
1127785992 15:62355131-62355153 CACTGGGTGCAGAGTGAAGCAGG + Intergenic
1128539444 15:68516064-68516086 CACTCTATGGAGGGAGAAGCAGG - Intergenic
1129175548 15:73837498-73837520 GAGTCTATGCTGAGGGAAGCTGG + Intergenic
1129525440 15:76210829-76210851 CACTCTTTGCTCAGGGAAGCAGG - Intronic
1130279659 15:82510555-82510577 CACCATTTGCAGAAGAAAGCAGG - Intergenic
1130390361 15:83448789-83448811 CACTCTTTCCATATGGAAACTGG + Intronic
1132781903 16:1631464-1631486 ACCACTTTGCAAAGGGAAGCTGG - Intronic
1133222823 16:4326484-4326506 GTCTCTTTGCAGAAGGAAGCGGG - Intronic
1133450993 16:5903909-5903931 CTGTCTTTGCTGAGGGAAGCTGG + Intergenic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1133915350 16:10104682-10104704 CACTTTTTGCCTAGGGAATCAGG - Intronic
1136176645 16:28521748-28521770 CGCTCATTGCAGATGGGAGCTGG + Intergenic
1137624808 16:49900866-49900888 CACTCTTTGCAGGGCAAAGCTGG - Intergenic
1137868635 16:51928160-51928182 CACGGTTTGCAAAGGGGAGCTGG + Intergenic
1140485199 16:75288085-75288107 CACTCTTTGCAGGGGAGAGGGGG - Intergenic
1140550096 16:75856275-75856297 CTCTCAGTGGAGAGGGAAGCTGG - Intergenic
1142238516 16:88934532-88934554 CACACTGTGCACAGGGAAGATGG - Intronic
1142413023 16:89925828-89925850 CACTCTGGGCAGAGGGAAGTCGG + Intronic
1142899737 17:3004538-3004560 ACCTCTGTGCAGAGGGAAGGCGG + Intronic
1145795448 17:27652975-27652997 CCCATTTTGCAGAGGGAAGGGGG - Intergenic
1146929334 17:36766695-36766717 TTCTCTATGCAAAGGGAAGCTGG + Intergenic
1148081733 17:44970609-44970631 CAAACTTTGCAGAGAGGAGCTGG + Intergenic
1150436028 17:65154917-65154939 TAGTCTTTGCAGAGACAAGCTGG + Intronic
1152932040 17:83114921-83114943 GACTCGTCGCAGAGGGGAGCAGG + Intergenic
1154140650 18:11821722-11821744 CACTGTTTGCAGAGGCAGGTGGG + Intronic
1154326189 18:13392488-13392510 TCCTCTGAGCAGAGGGAAGCAGG + Intronic
1156900931 18:42299538-42299560 GCCTCTTTCCAGAGGGATGCTGG - Intergenic
1157547292 18:48555440-48555462 CCCACTTTGCAGAGGAAGGCTGG + Intronic
1157582633 18:48782343-48782365 CACTGATTGCAGAGGGATGGGGG + Intronic
1158638071 18:59178701-59178723 CAGTCTTTGCAGGGGGGACCAGG + Intergenic
1159424904 18:68272518-68272540 CACTCTTGGGAGGGGGAAGGGGG - Intergenic
1160894172 19:1395034-1395056 CACACTTAGCAGTGGGGAGCAGG - Intronic
1161487209 19:4542885-4542907 CCCACTCTGCAGAGGGAAGCGGG - Exonic
1161842738 19:6692806-6692828 CAATCTTTGCAAAGGGAATTGGG + Intronic
1162272872 19:9630568-9630590 CCCTATTTACAGAGGAAAGCAGG + Intronic
1164886682 19:31784210-31784232 CAGCCTTTGCAGTGAGAAGCTGG - Intergenic
1166431513 19:42732039-42732061 CTCCCTTTGCAGAGGGCAGGTGG + Intronic
1166434635 19:42757252-42757274 CTCCCTTTGCAGAGGGCAGGTGG + Intronic
1166444506 19:42847278-42847300 CTCCCTTTGCAGAGGGCAGGTGG + Intronic
1166447484 19:42871018-42871040 CTCCCTTTGCAGAGGGCAGGTGG + Intronic
1166464194 19:43018025-43018047 CTCCCTTTGCAGAGGGCAGGTGG + Intronic
1166470348 19:43074611-43074633 CTCCCTTTGCAGAGGGCAGGTGG + Intronic
1166481475 19:43178136-43178158 CTCCCTTTGCAGAGGGCAGGTGG + Intronic
1166483945 19:43197252-43197274 CTCCCTTTGCAGAGGGCAGGTGG + Intronic
1166491063 19:43261117-43261139 CTCCCTTTGCAGAGGGCAGGTGG + Intronic
1166677858 19:44750188-44750210 CACTCTTGGAATAGGAAAGCTGG - Intronic
1168278127 19:55288108-55288130 CACTCTTGGCGTAGGGAGGCAGG + Intronic
1168521524 19:57054731-57054753 AACTTTTTCCAGAGGGCAGCAGG - Intergenic
926395287 2:12435025-12435047 CACTGATGGGAGAGGGAAGCAGG - Intergenic
926886660 2:17604519-17604541 CACTTTCCGCAGAGAGAAGCTGG + Intronic
927119179 2:19938675-19938697 CAATCTGAGCAGAGGGAAACAGG - Intronic
931178587 2:59877467-59877489 CACTGTTTGGGGAGGGAAGGGGG - Intergenic
931901317 2:66791540-66791562 CACTGAATGCAGAGGGAAGTTGG + Intergenic
935274566 2:101464916-101464938 CACCCTTATCAGAGGGAAGTGGG - Intronic
941945102 2:171087790-171087812 CACTATTTCCAGAGTGAAGTTGG - Intronic
945914623 2:215690250-215690272 CAATCTTTGAAATGGGAAGCTGG - Intergenic
947393636 2:229665757-229665779 CCATCTTTGCATAGGGAAGAAGG + Intronic
947588843 2:231373093-231373115 CACTCTGTGCTCAGGGAAGAAGG + Intronic
948861849 2:240756535-240756557 TGCCCTTTGCAGAGAGAAGCTGG - Intronic
1172638800 20:36428532-36428554 CACTCTTTGCTGAGGCCACCTGG + Intronic
1172957447 20:38771173-38771195 CACTCTGAGTAGAGGGAAACAGG - Intronic
1173327606 20:42048091-42048113 TGCTCTTTGCAGAGAGGAGCTGG - Intergenic
1178954437 21:37009911-37009933 CGCTCTTTGCAGAGCCCAGCTGG + Intronic
1182085931 22:27561201-27561223 CACTGTCTGCAGTGGTAAGCAGG + Intergenic
1182285269 22:29243433-29243455 CTCTCCTTGCAGGGGGAACCTGG + Exonic
1183259209 22:36783417-36783439 TTCTATTTGCAGAGGGAAGAAGG - Intergenic
1184341877 22:43890780-43890802 TGCTCTTTCCAGAGGGCAGCTGG - Intronic
950467514 3:13163869-13163891 CACTCTAAACACAGGGAAGCTGG + Intergenic
954133595 3:48572035-48572057 CATTCTGTGCAGGGTGAAGCTGG - Exonic
954888941 3:53905025-53905047 CACTTTTTGCAGAAGGGATCTGG - Intergenic
957079235 3:75622908-75622930 CCCTGTTTGCAGAAGGCAGCGGG - Intergenic
960386581 3:117028079-117028101 CACTCTTTGCTGATGGCTGCGGG + Intronic
960776169 3:121257247-121257269 GACTCCTTGAAGAAGGAAGCTGG - Exonic
961787032 3:129353473-129353495 AACTCCTATCAGAGGGAAGCTGG - Intergenic
962944619 3:140155763-140155785 AAGTCTTTGACGAGGGAAGCTGG - Intronic
964760130 3:160127593-160127615 CTCACTTTGCAGAGGGTAGTGGG + Intergenic
967833122 3:193939173-193939195 CTCTCTTTGAAGAATGAAGCTGG - Intergenic
968813443 4:2810211-2810233 CTATCTTCCCAGAGGGAAGCTGG - Intronic
968826955 4:2905650-2905672 CAGTCCATGCAGAGGGCAGCTGG - Intronic
969022323 4:4146863-4146885 CCCTGTTTGCAGAAGGCAGCGGG - Intergenic
969066122 4:4482693-4482715 CATTCTGGGCAGAGAGAAGCAGG - Intronic
969731550 4:8960530-8960552 CCCTGTTTGCAGAAGGCAGCGGG + Intergenic
970712107 4:18875988-18876010 CACTCTTTGCAGATGGCTGTGGG - Intergenic
973822524 4:54675394-54675416 AATTCTTTGCAAAGGGAAACAGG + Intronic
973866983 4:55124620-55124642 CTCTCCTTGCAGAGCGAAGAAGG - Intronic
977639412 4:99339575-99339597 ACCTCTTTCCAGAGCGAAGCAGG + Exonic
978387694 4:108192309-108192331 CCCTCTGGGCAGAGGGAATCAGG + Intergenic
980854353 4:138421532-138421554 GACTTTATGCAGAGGGAAGTGGG + Intergenic
981279503 4:142941002-142941024 CTCTTTTTGAAGAGAGAAGCAGG + Intergenic
986329930 5:6710550-6710572 AACTCTTTGCAGATGTAATCAGG + Intergenic
988860734 5:35275500-35275522 CACTCCATCCAAAGGGAAGCAGG - Intergenic
995106321 5:108381261-108381283 AACTCTTTGCAGCAGGAGGCGGG + Exonic
995106495 5:108381894-108381916 CATGCTTTGCCCAGGGAAGCCGG + Exonic
996016391 5:118538611-118538633 CTCACTTTGCAGATGGAAGACGG - Intergenic
998534303 5:142915287-142915309 CACGCCATGCAGAGGGAACCAGG - Intronic
998666039 5:144298418-144298440 CAGCCTTTACAGAGAGAAGCTGG + Intronic
1000974656 5:167751550-167751572 CACTTTTTGCAGAGAAAATCAGG + Intronic
1001278994 5:170372453-170372475 CAACCTCTGCAGAGGGAAGAGGG - Intronic
1001534286 5:172487887-172487909 CACGCTCTGAAGAGGGACGCAGG - Intergenic
1002028510 5:176411864-176411886 CATTCTTTAGAGAGGGAAGCAGG - Intronic
1002070963 5:176678763-176678785 AACTGTTGGCCGAGGGAAGCTGG + Intergenic
1003023895 6:2536406-2536428 CTCTCTTTGGAAAGGGAATCAGG + Intergenic
1004125245 6:12866692-12866714 TTTTATTTGCAGAGGGAAGCTGG - Intronic
1004182952 6:13396648-13396670 CACTCTTACAAGAAGGAAGCAGG + Intronic
1006140043 6:31923043-31923065 CACTCCAGGTAGAGGGAAGCAGG - Intronic
1006295874 6:33169874-33169896 ATCTCTTTGCAGGGGGAACCAGG - Exonic
1007687102 6:43673500-43673522 CATGCCTTGGAGAGGGAAGCTGG + Intronic
1008564234 6:52751574-52751596 CACCTTCAGCAGAGGGAAGCTGG + Exonic
1008568548 6:52792853-52792875 CACCTTCAGCAGAGGGAAGCTGG + Exonic
1008573003 6:52832856-52832878 CACCTTCAGCAGAGGGAAGCTGG + Exonic
1008577382 6:52874066-52874088 CACCTTCAGCAGAGGGAAGCTGG + Intronic
1010505921 6:76659203-76659225 CAATATTTGGAGAGGGAAGTGGG + Intergenic
1011410556 6:87061814-87061836 CATTTATTGCAGTGGGAAGCAGG - Intergenic
1013270118 6:108537498-108537520 CATTCTAGTCAGAGGGAAGCTGG + Intergenic
1013492025 6:110657156-110657178 CACTCTGTGCGGAGAGTAGCAGG + Intronic
1015785978 6:136922050-136922072 GACGCTCTGCGGAGGGAAGCGGG - Intergenic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018793167 6:167165531-167165553 CTGTCTTTGCTGATGGAAGCTGG - Intronic
1019405794 7:883352-883374 CTCTCTTGGCAGACGGAAGCTGG - Intronic
1022390626 7:29940866-29940888 CACTCTCTGCAGAGGGAGTGAGG - Exonic
1022592054 7:31672979-31673001 CACTTTGTTCACAGGGAAGCAGG - Intergenic
1022592084 7:31673190-31673212 AACTGTTGGCATAGGGAAGCTGG + Intergenic
1023022088 7:36019602-36019624 CACTGTCTGCAGAGAGAAGGGGG - Intergenic
1023352981 7:39338765-39338787 CAATTTCTGCAGAAGGAAGCTGG - Intronic
1024374199 7:48619066-48619088 CCCACTTTGCAGAGGAAGGCAGG + Intronic
1026409173 7:70101404-70101426 CACTCTTTTTAGAAGGAAGGAGG - Intronic
1028231511 7:88311217-88311239 CACTCTTTACAGAGGGTTGTCGG + Intergenic
1029161112 7:98552700-98552722 CTCTCTTTCCAAAGGGAGGCTGG + Intergenic
1031547729 7:123069956-123069978 CACACTTTGCAGAGATCAGCAGG + Intergenic
1032500583 7:132396861-132396883 CACCCTCTCCAGAGTGAAGCAGG + Intronic
1036185216 8:6616720-6616742 CACCATTAGCAGAGGAAAGCTGG + Intronic
1037760057 8:21735898-21735920 AACACTTTGAAGAGGGAGGCAGG - Intronic
1041128149 8:54666522-54666544 AACTCTTTTCAGGGAGAAGCTGG + Intergenic
1044449268 8:92314525-92314547 CATTCTTTGCAGAGAGTAGAGGG - Intergenic
1045544267 8:103114024-103114046 CCATCTCTGCAGTGGGAAGCTGG + Intergenic
1048237112 8:132701656-132701678 CACTTTATCCAAAGGGAAGCAGG - Intronic
1049365242 8:142233901-142233923 GATTCTGTGCAGGGGGAAGCTGG - Intronic
1049391481 8:142373782-142373804 CACTCCAGGCAGAGGCAAGCAGG + Intronic
1050296137 9:4207239-4207261 CACACTATGCAGAGGGAAGGTGG + Intronic
1051535636 9:18154350-18154372 CACTCTTTGGAGAGCTTAGCTGG + Intergenic
1052641228 9:31167628-31167650 CCTGCTCTGCAGAGGGAAGCAGG - Intergenic
1053447480 9:38164185-38164207 CTCACTGTGCAAAGGGAAGCAGG + Intergenic
1055022372 9:71684023-71684045 CACCCTGTGGAAAGGGAAGCTGG + Exonic
1056028257 9:82524057-82524079 CCCTCTTTGCAGATGCAAGGGGG - Intergenic
1056568158 9:87792991-87793013 CACCCTCTGCAGGAGGAAGCTGG - Intergenic
1056712337 9:89001123-89001145 CATTCATTTCAAAGGGAAGCGGG - Exonic
1059423475 9:114206687-114206709 CACTCTTTGTGGAGGGCACCTGG + Intronic
1059430282 9:114245854-114245876 GTCTCTTTGCAGGGGGAACCAGG + Exonic
1059580629 9:115544357-115544379 CAATGTTTGTAGAGGGGAGCTGG - Intergenic
1061374287 9:130214900-130214922 AGGTCTTTGCAGAGGGAAACTGG - Intronic
1186059055 X:5683876-5683898 CACCTTTTGCATAGGGCAGCAGG - Intergenic
1186581849 X:10828226-10828248 CACTCTTTGCTAAGGCAAGTGGG - Intronic
1188001198 X:24983942-24983964 CTCATTTTGCAGACGGAAGCAGG - Intronic
1188169686 X:26909780-26909802 CACTCTTTTCAGAGGCAAGTGGG + Intergenic
1189270710 X:39749868-39749890 CACTCCTAGCAGTGGGAGGCTGG - Intergenic
1189992642 X:46609269-46609291 CACTCTTTGCAGAGGGAAGCAGG + Intronic
1192806085 X:74510670-74510692 CAATAGCTGCAGAGGGAAGCAGG + Intronic
1197318000 X:124992213-124992235 CAGTCTTGGCAGTGGGGAGCAGG - Intergenic
1197765071 X:130054977-130054999 GACTCTTGGCAAAGGGAAACCGG + Intronic
1199188279 X:144940803-144940825 CACTCTTTGCCCAGGCCAGCTGG + Intergenic
1200163736 X:154022207-154022229 CACCCTGTGCAGAAGGGAGCTGG - Intronic
1201945335 Y:19504463-19504485 CAGACTTTCCAGAGGGAATCGGG + Intergenic