ID: 1189993772

View in Genome Browser
Species Human (GRCh38)
Location X:46619658-46619680
Sequence CAGAGCAATTACATTTGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 1, 2: 1, 3: 15, 4: 137}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189993772 Original CRISPR CAGAGCAATTACATTTGGGG AGG Intronic
906925242 1:50109026-50109048 CAAATCAATTATTTTTGGGGGGG - Intronic
911213520 1:95167316-95167338 TTAAGCAATTACATTTTGGGAGG - Intronic
911436509 1:97866256-97866278 CAGAGCAATTACTCATGTGGTGG + Intronic
911721870 1:101199962-101199984 GAGAAAAATTAGATTTGGGGAGG - Intergenic
913074891 1:115333607-115333629 CAGATCAACCTCATTTGGGGAGG + Intronic
920215745 1:204360407-204360429 TAGAGAAATAACATTTGGAGAGG + Intronic
921425894 1:215000704-215000726 AAGGGCAATTAGGTTTGGGGTGG + Intergenic
924685696 1:246287632-246287654 TATAGTAATTAGATTTGGGGGGG + Intronic
1064572248 10:16705936-16705958 CAGATCAAAAACATTTGGGCTGG - Intronic
1064954040 10:20887052-20887074 CAGAACAATCAAATTTGGGGAGG - Intronic
1067467599 10:46512711-46512733 CAGAGCAGATCAATTTGGGGTGG - Intergenic
1067619587 10:47871894-47871916 CAGAGCAGATCAATTTGGGGTGG + Intergenic
1068556125 10:58461049-58461071 CACAGCAATTAGCTTTGGTGAGG - Intergenic
1068584484 10:58781521-58781543 CAAAGCAATTAATTTTGGGAGGG + Intronic
1068795862 10:61079361-61079383 CAGAACAAGAGCATTTGGGGTGG + Intergenic
1069118234 10:64534980-64535002 CAAATTAAATACATTTGGGGGGG + Intergenic
1069356342 10:67590391-67590413 CAGATCAATTCCATTTCTGGTGG - Intronic
1070559380 10:77554298-77554320 CAAAGAAATTACTTTTGGGCTGG + Intronic
1071374530 10:84989032-84989054 CAGAGAAATGACATTTTCGGAGG + Intergenic
1071882528 10:89915003-89915025 CAGAAGAATTACTTTTGGGAGGG + Intergenic
1072218709 10:93309548-93309570 AAGGGCAATAATATTTGGGGAGG + Intronic
1072634253 10:97167172-97167194 CAGAGCCATCTCATTTGGAGAGG - Intronic
1072823048 10:98577422-98577444 CAGAGCAATAACATTGGGTGAGG - Intronic
1073755845 10:106579652-106579674 CAGAGCAGGAACATTTGGGGTGG - Intronic
1074979957 10:118611528-118611550 CAGAGCAGTTGCTTTTGAGGGGG - Intergenic
1075691167 10:124395251-124395273 CATACCAATTACAACTGGGGTGG - Intergenic
1075819887 10:125297855-125297877 CACTGCAATTACATTTTTGGAGG - Intergenic
1076077219 10:127543910-127543932 CAGTGGGATTACATTTGAGGAGG + Intergenic
1076905926 10:133361071-133361093 CAGAGCACTCACATTGTGGGAGG + Intergenic
1077884667 11:6378080-6378102 GAGAGCTATTGCATTGGGGGTGG + Intergenic
1079095761 11:17509344-17509366 CAGGGACATTACCTTTGGGGTGG + Exonic
1079551217 11:21700752-21700774 TAGATCAATTAAATTTGTGGTGG - Intergenic
1079745222 11:24118994-24119016 CAGAGTACTTACATCTGGGAGGG + Intergenic
1080678850 11:34454311-34454333 CAAATCAGTTACATCTGGGGAGG + Intronic
1083704169 11:64501794-64501816 AAGTGCAATTACAAGTGGGGCGG - Intergenic
1084764528 11:71299573-71299595 CAGAACAAGCACGTTTGGGGAGG - Intergenic
1085104155 11:73827512-73827534 CAGAGGATTTTCTTTTGGGGTGG + Intronic
1085421917 11:76370029-76370051 AATAGCAGATACATTTGGGGAGG + Intronic
1089011978 11:115138820-115138842 CAGATCAATTACACTAGGTGTGG + Intergenic
1091831491 12:3553802-3553824 CAGAGCACTTGGACTTGGGGAGG + Intronic
1096163730 12:49402908-49402930 CAGAGCAATTAGATTTCGTTTGG + Intronic
1097666140 12:62479439-62479461 CAGATCAAAAATATTTGGGGGGG - Intronic
1098139049 12:67432895-67432917 TAGAGCAATTACACAAGGGGCGG - Intergenic
1098786301 12:74760997-74761019 GAGAGAAAATAGATTTGGGGGGG - Intergenic
1103520638 12:121535601-121535623 AAGAGAAATTAAATTGGGGGTGG + Intronic
1104072257 12:125356092-125356114 CAGAGATATTATATTTGGAGGGG - Intronic
1104652842 12:130549116-130549138 CAGTGTGATTTCATTTGGGGAGG + Intronic
1107524100 13:41213453-41213475 CAGGGCAATTACACTGGTGGTGG - Intergenic
1109134957 13:58636306-58636328 AAGAGAAATTATATTTGGTGGGG - Intergenic
1118254850 14:64196636-64196658 CAGAGAAATTTAATTTGAGGAGG + Intronic
1118892280 14:69920509-69920531 CAGAACCATGACAATTGGGGAGG - Intronic
1119397886 14:74341268-74341290 GAGAGCAATTAGATCTGGGGAGG + Intronic
1120419399 14:84264180-84264202 CAAAGCAATTATTTTTGGGGTGG + Intergenic
1127082153 15:55391561-55391583 CTGAGCAATTAAATTTGCAGGGG + Intronic
1133949108 16:10375317-10375339 GACAGCAATAACATATGGGGAGG - Intronic
1135562246 16:23485876-23485898 CAGCACAACGACATTTGGGGAGG + Intronic
1135872481 16:26163694-26163716 CACAGCAATTCCATAGGGGGAGG + Intergenic
1138263404 16:55641984-55642006 GATAGCAGTTACCTTTGGGGAGG + Intergenic
1146651916 17:34612389-34612411 CAGGGCATTTCCAGTTGGGGAGG - Intronic
1147727658 17:42576733-42576755 AAGAGTAATTCCATTAGGGGAGG + Intronic
1156026737 18:32663349-32663371 CAAAGCAAATACATTTGATGAGG - Intergenic
1159228172 18:65568284-65568306 AATAGCAATTAAGTTTGGGGTGG + Intergenic
1159988552 18:74874696-74874718 AAGAGCAATTACAGTGGGGCAGG - Intronic
1166269022 19:41702080-41702102 CTCAGCATTGACATTTGGGGTGG + Intronic
1166417445 19:42606629-42606651 CTCAGCAATGACATTTGGGGTGG - Intronic
1166451793 19:42908236-42908258 CAGAGAAATCACATCTAGGGGGG - Intronic
1166454238 19:42927102-42927124 CAGAGAAATCACATCTAGGGGGG - Intronic
1166464032 19:43016431-43016453 CAGAGAAATCACATCTAGGGGGG - Intronic
1166470186 19:43073014-43073036 CAGAGAAATCACATCTAGGGGGG - Intronic
1166490907 19:43259521-43259543 CAGAGAAATCACATATAGGGGGG - Intronic
1166609209 19:44174284-44174306 CAGAGCATATTCATTCGGGGAGG + Intronic
1167636007 19:50656160-50656182 CACTGCCATCACATTTGGGGAGG - Intronic
931837125 2:66110854-66110876 CAGAGCAAGTACATCAGGGTGGG + Intergenic
933147683 2:78875205-78875227 CTGAGCACGTACATTTGGGGTGG + Intergenic
938605667 2:132890306-132890328 CCCAACAATTTCATTTGGGGAGG + Intronic
939977484 2:148735644-148735666 CAGAGCAAATAATTTTGGGATGG - Intronic
942516218 2:176756136-176756158 CAGGGCAATTGTATTTTGGGGGG + Intergenic
943586098 2:189742194-189742216 CTGAGCCAATACATTTGAGGTGG + Intronic
943774156 2:191747022-191747044 GAGAGGAATTACATGTGGGCGGG - Intergenic
945191139 2:207188781-207188803 CAGAGCAAATATATTTGGTCAGG - Intergenic
947140121 2:227012945-227012967 CAGAGCAGTCACATGTGGAGAGG + Intronic
1169090275 20:2856587-2856609 CACAGTGATTACCTTTGGGGAGG - Intronic
1173857439 20:46259459-46259481 CAGAGCACTTACAGGTGGTGTGG - Intronic
1173972622 20:47164365-47164387 CAGAGGAAAGGCATTTGGGGAGG - Intronic
1175662056 20:60821932-60821954 CAGCGCCATTGCATTTGGGCTGG - Intergenic
1176874486 21:14114709-14114731 CAGAGAAACTAGATTTGGGTGGG + Intronic
1177954626 21:27582353-27582375 CAGAGCATTTCCATTTGAAGTGG - Intergenic
1181502421 22:23324401-23324423 CAGAGAAATCACATCTGAGGAGG - Intergenic
1182987725 22:34736717-34736739 CATATCAATTACATTTATGGTGG + Intergenic
1183007365 22:34914510-34914532 CACAGCAATTACATTTGTGGTGG + Intergenic
949724176 3:7024359-7024381 CGCAGCAATTGCATTTGGTGTGG - Intronic
950689705 3:14646235-14646257 GAGAGCACTCACATTTGGGGAGG - Intergenic
954897065 3:53984704-53984726 CAGAGCAATTACAGTTTTGTGGG - Intergenic
956281875 3:67566334-67566356 CATTAGAATTACATTTGGGGGGG + Intronic
957202651 3:77156986-77157008 CTGATTAAGTACATTTGGGGTGG - Intronic
958464487 3:94441794-94441816 CAGAGTCATTACACTTTGGGAGG + Intergenic
958985352 3:100774345-100774367 CAGAGTAAACACATGTGGGGTGG + Intronic
960418228 3:117411604-117411626 CAGAGCCATTATTTTTGGGAAGG + Intergenic
964585088 3:158288843-158288865 CAGATCAAAAATATTTGGGGGGG - Intronic
964589766 3:158347848-158347870 AAGAGAAACAACATTTGGGGTGG - Intronic
965957117 3:174384324-174384346 AAGAGAAATTACCTTTGGTGAGG - Intergenic
966845862 3:184129222-184129244 CACAGCAATTACCTCTAGGGGGG + Intergenic
973306727 4:48660366-48660388 CTGAGAAATTAGATTTTGGGAGG + Intronic
974461907 4:62199184-62199206 GAGAGGAATAACATTTGGAGAGG + Intergenic
975217145 4:71768983-71769005 CAGAGCAAGTACATTTGGGGAGG - Intronic
975525362 4:75342932-75342954 CAGAGCAATTACTTCTGGGAAGG + Intergenic
982081737 4:151796851-151796873 CCGAGAAATTACATTTCGAGAGG + Intergenic
982779973 4:159480545-159480567 AAAAGCAAATACATTTGGGAGGG + Intergenic
983476745 4:168221209-168221231 CTGAGCACATAGATTTGGGGAGG - Intronic
988824723 5:34924065-34924087 TAGAGCAATTACATTTTGCTAGG - Intronic
988983238 5:36592696-36592718 CAGAGGCTTTACATTTTGGGTGG - Intergenic
990514333 5:56517761-56517783 TAGAGCATTTACATGTGGCGAGG - Intronic
991175539 5:63683479-63683501 CAGAGCAAATGCACCTGGGGCGG + Intergenic
993979271 5:94524706-94524728 AATAGCAATTATATTTGGGTGGG + Intronic
997582174 5:135024997-135025019 CAGAGCAATTTCATGAGGGAGGG - Intergenic
999123656 5:149229997-149230019 CAGAGCTATCACATTTAAGGGGG - Intronic
999432953 5:151539876-151539898 CAGGGCAATTTCATTTGGTGAGG - Intronic
1000578946 5:163011619-163011641 CAGTTCAATAATATTTGGGGAGG - Intergenic
1000980075 5:167807317-167807339 CAGAGCAATTGCTTTAGGGATGG - Intronic
1002705441 5:181158321-181158343 GAGAGGAAATACATGTGGGGGGG + Intergenic
1002768850 6:270220-270242 CTCAACAAATACATTTGGGGAGG - Intergenic
1003475902 6:6482403-6482425 GAGAGAGATTACATTTGGGGTGG + Intergenic
1012538980 6:100337756-100337778 CAGAGAATTTCCATTTGGTGTGG + Intergenic
1021827483 7:24570097-24570119 CAGAGCAATTAAGTCTGGGATGG + Intergenic
1022019607 7:26385576-26385598 CAGCTCAATTACCTTTGGTGTGG - Intergenic
1022094346 7:27129842-27129864 CAGGGCAATTAAATTTATGGGGG + Intronic
1024383360 7:48724229-48724251 CAGAGCAATAAGATTTGGGTGGG + Intergenic
1026099336 7:67371757-67371779 CAGAGCAATTACAAGTGGTTAGG + Intergenic
1029234227 7:99099848-99099870 CTGAGCATTTGCATCTGGGGAGG - Intronic
1031365624 7:120897272-120897294 AAGATCAGGTACATTTGGGGTGG + Intergenic
1032236077 7:130124479-130124501 CAGAGGATTTACATCTTGGGAGG + Exonic
1034773901 7:153806304-153806326 CAGAGAAATTACATCTGGATAGG - Intergenic
1038879917 8:31598169-31598191 GAGAGCAAGTACATTTAGGGTGG + Intergenic
1038902446 8:31858682-31858704 CTGAACAATTACATCTGGGAAGG + Intronic
1041149687 8:54918382-54918404 CAGAGGAATCCCTTTTGGGGTGG - Intergenic
1041574147 8:59374076-59374098 TGGAGCAATTTCATTTGGGTTGG + Intergenic
1041636843 8:60154511-60154533 CATTGCAATGACATTTAGGGTGG - Intergenic
1044268421 8:90210435-90210457 CAGTGCAAGTATATTTTGGGAGG + Intergenic
1046558262 8:115804008-115804030 CAAAGCATTTGCATTTGGGGTGG - Intronic
1049230541 8:141479195-141479217 CTGAGCCAGTACCTTTGGGGAGG + Intergenic
1052682482 9:31711418-31711440 CACAGCAATTACATTTAGATTGG - Intergenic
1054848554 9:69822136-69822158 GATAGTAATTACATTTGGAGTGG + Intronic
1054943208 9:70766721-70766743 CAGAGTCATGACATTTGGGGAGG - Intronic
1056551848 9:87659194-87659216 CAGACCTATTACTTCTGGGGAGG - Intronic
1056966170 9:91164496-91164518 CAAAGCAATTCAATTTGGAGTGG + Intergenic
1061776139 9:132965836-132965858 TATAGCAATTACATGTTGGGTGG - Intronic
1186547108 X:10461364-10461386 TAGAGAAAATAAATTTGGGGAGG - Intronic
1187491131 X:19752560-19752582 AACAGCAGTTACACTTGGGGAGG + Intronic
1188475037 X:30583014-30583036 AATAGCAATTGCCTTTGGGGAGG - Intergenic
1189129493 X:38483685-38483707 CAAAGCAATTACAATGGAGGTGG - Intronic
1189993772 X:46619658-46619680 CAGAGCAATTACATTTGGGGAGG + Intronic
1190039696 X:47060220-47060242 GAGAATAATTACATTTGCGGGGG + Exonic
1191883643 X:65866606-65866628 AAGGGCAAATACTTTTGGGGAGG - Intergenic
1196530614 X:116782351-116782373 CAGTGCTATTTTATTTGGGGTGG + Intergenic
1196648464 X:118144180-118144202 CAGAGAAATTACATTTCAGAGGG - Intergenic