ID: 1189995846

View in Genome Browser
Species Human (GRCh38)
Location X:46636683-46636705
Sequence CTGTCTGTGCTGTGGCACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 5, 3: 30, 4: 223}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189995846_1189995849 16 Left 1189995846 X:46636683-46636705 CCAAAGTGCCACAGCACAGACAG 0: 1
1: 0
2: 5
3: 30
4: 223
Right 1189995849 X:46636722-46636744 TGTGATATTCAAATTTCACTGGG 0: 1
1: 3
2: 39
3: 356
4: 1072
1189995846_1189995850 17 Left 1189995846 X:46636683-46636705 CCAAAGTGCCACAGCACAGACAG 0: 1
1: 0
2: 5
3: 30
4: 223
Right 1189995850 X:46636723-46636745 GTGATATTCAAATTTCACTGGGG 0: 1
1: 0
2: 4
3: 42
4: 286
1189995846_1189995848 15 Left 1189995846 X:46636683-46636705 CCAAAGTGCCACAGCACAGACAG 0: 1
1: 0
2: 5
3: 30
4: 223
Right 1189995848 X:46636721-46636743 CTGTGATATTCAAATTTCACTGG 0: 1
1: 1
2: 13
3: 99
4: 714
1189995846_1189995853 30 Left 1189995846 X:46636683-46636705 CCAAAGTGCCACAGCACAGACAG 0: 1
1: 0
2: 5
3: 30
4: 223
Right 1189995853 X:46636736-46636758 TTCACTGGGGGAGGTAACTGAGG 0: 1
1: 0
2: 3
3: 28
4: 217
1189995846_1189995852 21 Left 1189995846 X:46636683-46636705 CCAAAGTGCCACAGCACAGACAG 0: 1
1: 0
2: 5
3: 30
4: 223
Right 1189995852 X:46636727-46636749 TATTCAAATTTCACTGGGGGAGG 0: 1
1: 0
2: 2
3: 13
4: 198
1189995846_1189995851 18 Left 1189995846 X:46636683-46636705 CCAAAGTGCCACAGCACAGACAG 0: 1
1: 0
2: 5
3: 30
4: 223
Right 1189995851 X:46636724-46636746 TGATATTCAAATTTCACTGGGGG 0: 1
1: 0
2: 4
3: 49
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189995846 Original CRISPR CTGTCTGTGCTGTGGCACTT TGG (reversed) Intronic
900556520 1:3283513-3283535 CTGTCTCTGCTGTGGACCTAGGG - Intronic
900793960 1:4696442-4696464 CTGGCTATGCTGTGTCCCTTTGG + Intronic
900872227 1:5312249-5312271 CTCTCCCTGCTCTGGCACTTGGG - Intergenic
901537014 1:9889109-9889131 GTGCCTGTGCTGGAGCACTTTGG - Intronic
901622122 1:10597065-10597087 CAGACTGTGCTGTGGCCCTGAGG - Intronic
901637471 1:10676995-10677017 CTGCCTGGGCTCTGGCACGTAGG + Intronic
902624968 1:17671255-17671277 CTTTCTGCGCTGGGGCAGTTAGG + Intronic
903192553 1:21664998-21665020 CAGTCTCTGCTGTGTGACTTTGG - Intronic
903540094 1:24092016-24092038 CAGGCTGTGCTGTGTCATTTAGG - Intronic
904354721 1:29931494-29931516 CTCTCTGTGCAGAGACACTTCGG - Intergenic
904801732 1:33097796-33097818 CTGCCTTTGCTGGGGCACCTAGG + Intronic
905484449 1:38285598-38285620 CTCTTTGAGCTGTGGCACCTTGG + Intergenic
905503971 1:38461973-38461995 CTGTCAATGCTGTTGCACTGGGG - Intergenic
905800249 1:40838361-40838383 CTGCCTGCGCTCTGGCACCTCGG + Exonic
906528177 1:46508595-46508617 CTCTCTGTGCTCTGGTCCTTGGG - Intronic
907002636 1:50877120-50877142 CTACCTGTGCTGTCGCCCTTGGG - Intronic
907458732 1:54592777-54592799 CTGTCTGTGTTCTGGGATTTGGG - Intronic
909713591 1:78680160-78680182 CTGTTTGAGGTATGGCACTTTGG - Intergenic
910289903 1:85589463-85589485 CTGTGTGTGCTGAGCCACCTGGG - Intergenic
913652274 1:120928803-120928825 CTCTCTGTGCTGTGGGACACTGG - Intergenic
914168836 1:145200268-145200290 CTCTCTGTGCTGTGGGACACTGG + Intergenic
914523957 1:148444227-148444249 CTCTCTGTGCTGTGGGACACTGG + Intergenic
914599719 1:149191642-149191664 CTCTCTGTGCTGTGGGACACTGG - Intergenic
914642448 1:149622913-149622935 CTCTCTGTGCTGTGGGACACTGG - Intergenic
915104853 1:153527442-153527464 CTGTGTCTGCTGAGGGACTTGGG - Intergenic
916369188 1:164070666-164070688 CTGTTTGTGCTGTATCCCTTAGG + Intergenic
917364128 1:174209879-174209901 CTCTCTGTTCTGTGCCACCTGGG - Intronic
917664421 1:177210271-177210293 CTGTCTCTGCTCTGGAACTTAGG - Intronic
918110233 1:181449179-181449201 CTATTGATGCTGTGGCACTTTGG + Intronic
918441937 1:184576449-184576471 CTGTCTGTTCTGTAGCAGTTAGG - Intronic
921003968 1:211074617-211074639 TTGGCTATGCTGTGGCACTCAGG + Intronic
921309455 1:213828292-213828314 CTGGGTGTGATGTGGCACTGTGG - Intergenic
921427367 1:215020135-215020157 CTTTCAGAGGTGTGGCACTTTGG + Intronic
921431058 1:215066558-215066580 CTGTTTTTGGTGTGGCTCTTTGG + Intronic
922857529 1:228787860-228787882 ATTTCTGTGCTGTTGTACTTAGG - Intergenic
923013262 1:230105677-230105699 CTGTCGGTGCTGTCTCACTGTGG + Intronic
924421368 1:243913209-243913231 CTGTCTGTGCAGTGGCTCACTGG - Intergenic
1062969323 10:1634046-1634068 CCGGCTGTGCTGTGGCTCCTGGG + Intronic
1063462673 10:6224373-6224395 CTGTCTGTTCTGTGGCTTCTGGG + Intronic
1069641222 10:69956688-69956710 CAGTCTCTGCTGTGGCCCTATGG - Intronic
1070282100 10:75057458-75057480 CTGACTGAGCTGTGGGACTTGGG + Intronic
1070680912 10:78448440-78448462 CTGACTGTCCTTTGGGACTTGGG + Intergenic
1071342870 10:84664675-84664697 CAGTCTGTTCTGTGTCACTTGGG - Intergenic
1071986831 10:91060458-91060480 CTGTCTTCATTGTGGCACTTGGG + Intergenic
1072772015 10:98149778-98149800 ATGTGTGTTCTGTGGCACTTGGG + Intronic
1075595905 10:123728956-123728978 CAGTCTGTGCAGTGGCTCTGAGG - Intronic
1076573118 10:131445451-131445473 CTGTCTGTGCAGTGGTCCTGTGG - Intergenic
1077029055 11:455455-455477 CTGTCTGTGCTGTGGGCCCTTGG + Intronic
1080919350 11:36693703-36693725 CTGCCTCTTCTGTGGCTCTTAGG + Intergenic
1083270730 11:61571201-61571223 GTGTCTGTGCAGAGGCACATGGG - Intronic
1083430775 11:62612726-62612748 CTGTTTGTGCTGCGGCGCTGTGG - Exonic
1084936203 11:72588058-72588080 CAGTTTGTGCTGTGTCACATAGG - Intronic
1085041687 11:73330668-73330690 TTGTCTGTACTGTGTGACTTTGG + Intronic
1085556467 11:77427185-77427207 CTGTCTCTGCAGAGACACTTAGG - Intronic
1085581053 11:77650945-77650967 CTGTGTGAGCTGGGGCACTTCGG + Intergenic
1085582488 11:77667041-77667063 CTGGCTGTGCTGTTGTCCTTGGG + Exonic
1086421080 11:86638021-86638043 CTGTCTTTACTATGGCACCTGGG + Intronic
1086971604 11:93086680-93086702 CTGGCTGTGCTGTGGCCCAATGG + Intergenic
1087840401 11:102914833-102914855 CTGTCAGTGCTGTGAGACTAGGG - Intergenic
1087891459 11:103542292-103542314 CTCTATGCACTGTGGCACTTGGG + Intergenic
1088154736 11:106789865-106789887 CTCTCTGTGCTGAGCCACCTGGG + Intronic
1089587735 11:119520809-119520831 CTGTCTCTGCCCTGGCACCTGGG - Intergenic
1094399426 12:30045438-30045460 CTGTCTGTGATTAGGCACTAAGG + Intergenic
1094539605 12:31352224-31352246 CTGTCTGGGATGTGGGACTTGGG - Intergenic
1096249362 12:50018516-50018538 GTTTCTGTCCTGTAGCACTTAGG - Intronic
1096608469 12:52784889-52784911 CTTTCTCTGCAGTGGCACTGTGG + Intergenic
1097280332 12:57841560-57841582 CTGCCTGGGCTGTGGGACTTTGG - Intronic
1100802655 12:98249723-98249745 CTATCTCTGCTGTGATACTTGGG + Intergenic
1103982736 12:124746990-124747012 CTGCCTCTGCTGTGGGTCTTGGG + Intergenic
1104658247 12:130590356-130590378 CTCTTTGTGCTGTGGCCCTGGGG - Intronic
1105501135 13:20972919-20972941 CTGTCTGTGCTGTGCAACCCTGG + Intergenic
1105817637 13:24051469-24051491 CTGCCTGGGCGATGGCACTTGGG + Intronic
1106547895 13:30746155-30746177 GTGGCTATGCTGTGTCACTTGGG + Intronic
1107636742 13:42399761-42399783 CTGTTTGTGATGTGGCCCTGTGG + Intergenic
1108041138 13:46340214-46340236 GTGTCTGTGCTGTGGCCTTTTGG - Intergenic
1108951194 13:56096537-56096559 CTGTCAATTCTATGGCACTTTGG - Intergenic
1109603902 13:64666570-64666592 TTTTCTGTGCTGTTACACTTGGG - Intergenic
1109922355 13:69082333-69082355 CAGTCTCTACTGTGTCACTTTGG - Intergenic
1113347412 13:109493900-109493922 GTGTCTGTGCTGTATCACTAAGG + Intergenic
1113388200 13:109870477-109870499 CTGACACTGCCGTGGCACTTGGG - Intergenic
1113860826 13:113485435-113485457 TTTTCTTTGCTGTGGCACTGGGG - Intronic
1116956876 14:50932991-50933013 CTCTTTGAGCTGTGGCTCTTCGG + Intronic
1117724192 14:58656353-58656375 ATGTCTGTGCTGTGCTGCTTTGG + Intergenic
1117890579 14:60417687-60417709 CCCTCTGTGCTGTGAAACTTGGG - Intronic
1118588493 14:67380185-67380207 GTCCCTGTCCTGTGGCACTTAGG + Intronic
1118744965 14:68767150-68767172 CTCTGTGTTCTGTGGCATTTTGG + Intergenic
1118863570 14:69684620-69684642 CGGTCTGTGCCAAGGCACTTGGG - Intronic
1122203455 14:100136444-100136466 CTGTCTAAGCTGTGGCAGATGGG + Intronic
1122472065 14:101975526-101975548 CTGACTTTGCTGTGTGACTTTGG - Intronic
1124348240 15:28936699-28936721 CTGACTGGGCTGTGCCACCTGGG + Intronic
1127368193 15:58310762-58310784 GTGGCTGTGCTGTGGCACCCTGG - Intronic
1127873495 15:63092456-63092478 CTGTCTTAGCTTTGGCACCTTGG + Intergenic
1129751795 15:78070504-78070526 CTGTGTGTGCTTAGGCACTGGGG - Intronic
1129797134 15:78386472-78386494 CTGGCTGAACTGTGGCAGTTTGG - Intergenic
1130874940 15:88005670-88005692 TTTTCTGTGCTCTGGCCCTTAGG - Intronic
1135161672 16:20102059-20102081 CTGGGTGTGCAGAGGCACTTAGG + Intergenic
1135497874 16:22968415-22968437 CTGTCTCTGCTGGGGCACTGGGG + Intergenic
1137247574 16:46718079-46718101 GTTTATGTGCTGTGGCCCTTTGG - Intronic
1137301905 16:47157392-47157414 CTGTATCTCCTGTGGCACTGTGG - Intronic
1141677777 16:85526557-85526579 CTGTCTGTGCTGTGTCCCTTTGG - Intergenic
1144739154 17:17571600-17571622 CTTTCTGGGCTGTGGCTCTAGGG - Intronic
1146255453 17:31389591-31389613 CTTTCTGTGCTGAGCCCCTTGGG + Intergenic
1146301432 17:31692682-31692704 CCGACTGTGATGTGGCACTTGGG + Intergenic
1149854024 17:60063525-60063547 TTGGCAGTGCTGTGGTACTTGGG - Intronic
1150591143 17:66563801-66563823 CTGTCTGTGCAGAGGTACGTTGG + Intronic
1151356118 17:73559657-73559679 CTGCCTGTGGGGTGGCCCTTCGG - Intronic
1151927755 17:77211354-77211376 CTGTCGGTGCTGTGTAAGTTTGG + Intronic
1152199203 17:78935325-78935347 CTGCCTGTCCTGTGGGACTGTGG + Intergenic
1152596261 17:81239177-81239199 CTGTCTGTGCTCTGGGACTTCGG - Intergenic
1153453949 18:5260094-5260116 CTCTCTGTTCTGAGCCACTTGGG - Intergenic
1155087873 18:22475218-22475240 CTCTCTGTGCTGTGGCCCTGAGG + Intergenic
1156777148 18:40805441-40805463 CTGTCCCTGCTGTGGGACTGAGG + Intergenic
1159209751 18:65302441-65302463 TTTTCTGTCCTGTGCCACTTTGG + Intergenic
1159255819 18:65943809-65943831 ATGTCTGTGCTGCAGCACGTGGG - Intergenic
1159454047 18:68638650-68638672 CTGTCTCTGCTGTGTCATGTAGG + Intergenic
1159939711 18:74397578-74397600 CTGTCTGAGCTGAGACACTGAGG - Intergenic
1160025131 18:75209977-75209999 GTGTCTGTGCTCTGGGAATTTGG - Intergenic
1161166006 19:2787870-2787892 CTGTCTGCACTGTGGCCATTGGG - Intronic
1162567967 19:11454422-11454444 CTGCCTGTGCTGTCTCTCTTGGG + Exonic
1163631182 19:18418657-18418679 GTGTCTGTGTTGTGTGACTTCGG + Intergenic
1163736823 19:18986690-18986712 CTCTCTGTGCTGTGTAACCTGGG - Intergenic
1164628519 19:29745573-29745595 CTGTCTTTCCTGTGGAACTCAGG - Intergenic
1165120439 19:33555390-33555412 CTGTCTGTGTGGTGGCCCTATGG - Intergenic
927810304 2:26176623-26176645 CATTCTGTTCTGTGGCACTCTGG + Intronic
931231841 2:60381707-60381729 TTATCTGTGTCGTGGCACTTTGG - Intergenic
934178657 2:89600048-89600070 CTGTCCTTGCTGTGGCACTGTGG - Intergenic
934679424 2:96272081-96272103 CTATATGTGCTGTGGGCCTTAGG - Intronic
936024514 2:109021152-109021174 CTGCCTGGGCTGTGGCACATTGG + Intergenic
938616300 2:133002630-133002652 CTGTGTTTTCTGTGGCATTTCGG - Intronic
938739719 2:134219569-134219591 GTGACTTTGCTGTGGCACTCCGG - Intronic
939567000 2:143797014-143797036 TTGTCTGTGAAGTGGAACTTGGG - Intergenic
942677202 2:178440138-178440160 CTGTCTGTGCTTTGTAATTTTGG + Intronic
943830065 2:192449598-192449620 ATGTCTATGCTGTGCCACTCAGG + Intergenic
944535408 2:200704768-200704790 CTGTGTGTTCTCTGGGACTTGGG - Intergenic
946428081 2:219610258-219610280 CTGTTTGCGCTGTGTCACTAAGG - Intronic
946699653 2:222399199-222399221 CTGACTGTGCTCTGTGACTTAGG - Intergenic
947007474 2:225528814-225528836 CTGCCTGTTCTGTAGCATTTTGG + Intronic
948483668 2:238266380-238266402 ATGCCTGTGGTCTGGCACTTTGG - Intronic
948900329 2:240953519-240953541 CCGTCTGTGCTGTGCCCCTGGGG - Intronic
949007251 2:241656611-241656633 CTGCAAGTGCTGTGGCACTCAGG + Intronic
1170781658 20:19430991-19431013 CTGTCTGTGCTGGGGTCCTGAGG - Intronic
1170982596 20:21228620-21228642 CTCTCTTTGCTCTGGCTCTTGGG - Intronic
1171041918 20:21772274-21772296 ATGACTGTGCTATCGCACTTCGG - Intergenic
1171395413 20:24829784-24829806 CTGTCTTTGCTGCGGCAGTGTGG - Intergenic
1173029204 20:39339062-39339084 CTGGCTGTGCTGGGGGACTAGGG + Intergenic
1174172577 20:48626665-48626687 CTGTGCGTGCTGTGGCGCTGGGG - Intronic
1175218017 20:57401556-57401578 CCTGCTGTGCTGGGGCACTTGGG + Intronic
1175814698 20:61877327-61877349 CTGTGTCTGCTGTGGGCCTTGGG - Intronic
1177620567 21:23586407-23586429 CTGTCAGTGCTGTATCATTTTGG + Intergenic
1179129659 21:38623693-38623715 CTGTCAGTGCTGAGCAACTTAGG - Intronic
1179481300 21:41680357-41680379 TTGTCTTTGCTTTGGCATTTTGG - Intergenic
1181189684 22:21129071-21129093 AGGCCTGGGCTGTGGCACTTTGG + Intergenic
1181209519 22:21281433-21281455 AGGCCTGGGCTGTGGCACTTTGG - Intergenic
1182248435 22:28979665-28979687 CTGTTTTTGCTGAGCCACTTGGG - Intronic
1184176343 22:42791693-42791715 CTGTCTGTCCTGTTTCCCTTGGG - Intergenic
1184601911 22:45548841-45548863 CCATCTGTGCTGTGGCCCTTGGG - Intronic
1203217425 22_KI270731v1_random:14002-14024 AAGCCTGGGCTGTGGCACTTTGG + Intergenic
950174669 3:10864567-10864589 GTGTCTGTGATGGTGCACTTGGG + Intronic
953462039 3:43089184-43089206 CTGCCCGTGCTGTGACACTTTGG - Intronic
954115284 3:48463770-48463792 GTCTCTGGGCTGAGGCACTTTGG - Exonic
956601976 3:71032278-71032300 CTGTCTGTGCAGTGGCACTGAGG + Intronic
957235101 3:77577491-77577513 CAGACTGTGGTGGGGCACTTGGG - Exonic
960133245 3:114079671-114079693 ATGTATCTGCTGTGTCACTTTGG - Intronic
960632440 3:119745894-119745916 CTGTTTGTGGATTGGCACTTTGG - Intronic
962097943 3:132311451-132311473 CTGACTGTACTGAGGCACTCAGG - Intergenic
962457071 3:135574388-135574410 CTGTCTGCCCTGTGGGACTGTGG - Intergenic
967440549 3:189502855-189502877 ATCTCTGTGTTGTGGCACTGTGG + Intergenic
967458104 3:189713047-189713069 CTGTCTGTGCTGTGGTGGTCTGG - Intronic
968079405 3:195835869-195835891 CCGTCTGAGCTCTGGCTCTTGGG - Intergenic
968137125 3:196227667-196227689 GTGTCTGTGCTGTGCTGCTTTGG + Exonic
969198680 4:5584503-5584525 CTGTCTGTGCTGTGGGGTTGTGG - Intronic
970025917 4:11623950-11623972 GTGTCTGTCCTGTGGGAATTAGG + Intergenic
970083228 4:12314448-12314470 CAGTGTGTTTTGTGGCACTTTGG - Intergenic
970780872 4:19736156-19736178 CTCACTGTGCTGTGTCACCTAGG - Intergenic
971576378 4:28280398-28280420 CTGTCTTTGCTGTGTCACATAGG - Intergenic
972438119 4:39054659-39054681 CTCTTTCTGCTGTGTCACTTAGG + Intronic
974474303 4:62360362-62360384 CTGGCTGTGGTTTGGCACATTGG + Intergenic
975301094 4:72791911-72791933 CTGCCTCTGCTGTGTCACATAGG - Intergenic
976179026 4:82381714-82381736 GTCTCTGTCCTGTGGCTCTTTGG + Intergenic
978550794 4:109924045-109924067 CTTTCTTTTTTGTGGCACTTTGG - Intronic
981674451 4:147324988-147325010 TTGTATTTGTTGTGGCACTTTGG - Intergenic
982299526 4:153865045-153865067 CTGTCTCTGCTGTGTCACACAGG + Intergenic
985141475 4:186844413-186844435 TTTTCTGTGCTGTGCCACTGTGG + Intergenic
986821216 5:11468910-11468932 TTGCCTGTGCTGTGGCCCTAAGG + Intronic
986832392 5:11594629-11594651 TTGACTATGCTGTGGCCCTTTGG + Intronic
986965348 5:13263737-13263759 CTGACTCTGCAGTGGCACCTTGG - Intergenic
989727452 5:44603829-44603851 CTGTCTCTGCTGTGTCACACAGG - Intergenic
989984537 5:50682577-50682599 CTCTCTGTGCTGTGGGACACTGG - Intronic
990477389 5:56174511-56174533 CTGTCTGAGATATGGGACTTCGG + Intronic
993126182 5:83838497-83838519 CTGTCTCTCTGGTGGCACTTGGG + Intergenic
996520519 5:124420836-124420858 TTCTCTGTGCTGTGCTACTTGGG - Intergenic
996961405 5:129254958-129254980 CTCTCTGTTCTGAGCCACTTGGG + Intergenic
997200982 5:132010119-132010141 CTGGCTGTGCAGGGGCACTCTGG - Intronic
999511980 5:152261614-152261636 GTGTGTGAGATGTGGCACTTGGG + Intergenic
999652400 5:153780248-153780270 CTGTCTCAGCTCTGCCACTTGGG + Intronic
999736682 5:154518236-154518258 CTGGCTGTGCTGTGTGACCTTGG + Intergenic
999767429 5:154752186-154752208 CTGGCTCTGCTGTGTGACTTTGG + Intronic
999796642 5:154995048-154995070 CAGTCTGTGCTGAGGACCTTAGG + Intergenic
1001565316 5:172696121-172696143 CTGCCTGTGCTGTGGGATCTTGG + Intergenic
1001813244 5:174646631-174646653 CTGTCTGGGTTGAGGCACTGGGG + Intergenic
1002954724 6:1850921-1850943 CCGTCTCTGCTGTGGGAATTAGG + Intronic
1003747205 6:9016023-9016045 CTGGCAGAGCTCTGGCACTTTGG + Intergenic
1003766770 6:9245786-9245808 TCATCTTTGCTGTGGCACTTCGG - Intergenic
1004737515 6:18422471-18422493 CTGTCTGGGCTTTGGCCTTTGGG + Intronic
1005013004 6:21353809-21353831 CTGCCAGAGCTGTGGCACTTTGG + Intergenic
1005637081 6:27762665-27762687 CTATCTGCGCTGTGGCGCTCGGG - Intergenic
1006110428 6:31741169-31741191 CTGTGTGTGCTGTGGAATTCAGG + Exonic
1006516575 6:34548939-34548961 CTGGCTGTGCTGTGTGACTGTGG - Intronic
1006749103 6:36365514-36365536 CTGTATCTGCTGTGGGACTTTGG - Intronic
1006930780 6:37686940-37686962 CAGCCTGTGCTGTGGCAGATGGG - Intronic
1007589182 6:43011302-43011324 CTGTGTGGGCTGTGGCCCTGTGG - Exonic
1010548327 6:77186765-77186787 CTGCTTTTGCTGTGTCACTTAGG - Intergenic
1017984162 6:159427968-159427990 CTGTCTGGCCTGTGGCACTTTGG - Intergenic
1018710580 6:166495652-166495674 TTGTCTGTGCTGGGGCATCTTGG + Intronic
1019100447 6:169625483-169625505 CTGTCTGTGCTCTTGCTCTGTGG - Intronic
1019388708 7:773511-773533 CTCTCTGAGCTGTGGCCCTTGGG + Intronic
1019489834 7:1307163-1307185 CTGTCTCTGCTCTGTCCCTTGGG - Intergenic
1022544300 7:31171355-31171377 GTGTATCTGCTGTGTCACTTTGG - Intergenic
1024411749 7:49050864-49050886 ATGTATGTGGTGTGGCATTTGGG + Intergenic
1024504602 7:50151303-50151325 CTGTATGAGGTGTGGAACTTGGG - Intronic
1024644572 7:51360495-51360517 CTGTCTGTGCTTTTGCAGTGAGG + Intergenic
1027520782 7:79204052-79204074 CTCTCTGTGCTGTGGCACCTTGG - Intronic
1032555522 7:132829615-132829637 CTGTTCTTGCTGTGGCAGTTGGG - Intronic
1035929766 8:3767151-3767173 CTGTCTGTGCTGTGCTTCTTAGG + Intronic
1036076950 8:5512751-5512773 CTGTGTGTGCTGTGGCAATGTGG + Intergenic
1038074630 8:24057790-24057812 ATGTCTGTGGTGTGGCTCTAGGG - Intergenic
1039968360 8:42299922-42299944 CTGTCTGTGCCTTGGCAGTGAGG + Intronic
1040967036 8:53093094-53093116 CTGTCTCTGCTGTGTCACACAGG + Intergenic
1042544591 8:69939955-69939977 CTGTATGTACTGTGGCTCTTTGG + Intergenic
1043330164 8:79106658-79106680 CTGTCTGTGCTGTTGCTATTGGG - Intergenic
1044026859 8:87183865-87183887 CACTTTGTTCTGTGGCACTTTGG + Intronic
1044604027 8:94033478-94033500 CTGGCTGTGCTGTGTGACCTTGG - Intergenic
1046391238 8:113575595-113575617 ATCTCTGTGCTGTGCCTCTTGGG + Intergenic
1050174741 9:2857944-2857966 CTGTCTGTTCTGAGGCAATTCGG + Intergenic
1051713617 9:19958431-19958453 CTGTCTGTACTGTGGAGCTTGGG - Intergenic
1052006671 9:23357695-23357717 CTGTCTCTGCTGTGTCACACTGG + Intergenic
1053186523 9:36021174-36021196 GTGTCTGTGCCGTGGCCGTTTGG - Intergenic
1055336261 9:75236323-75236345 CTGTATGTACTGTGGCACCTGGG + Intergenic
1056101682 9:83305806-83305828 CAGTCTTTGCATTGGCACTTTGG - Intronic
1056430640 9:86524890-86524912 GAGTCTGGGCTGTGCCACTTTGG - Intergenic
1060207717 9:121692321-121692343 CTGTATGTGTGGTGGCACTGGGG + Intronic
1061019698 9:128006152-128006174 CTTCCTGTGCTGTGGCAGCTGGG - Intergenic
1062563824 9:137154836-137154858 CGGCCTCTGCTGTGGGACTTTGG - Intronic
1186876571 X:13823932-13823954 CTGCCTGTGCTGTGCCCATTTGG - Intronic
1187569298 X:20484620-20484642 CTATCTGTACTGGGGCACATTGG - Intergenic
1188314077 X:28652298-28652320 CTGTGTGTGCTATGGGAGTTAGG - Intronic
1189995846 X:46636683-46636705 CTGTCTGTGCTGTGGCACTTTGG - Intronic
1190417333 X:50192921-50192943 CTGAAAGTGCTTTGGCACTTTGG + Exonic
1192152099 X:68718808-68718830 CTGCCTGTGCTGTGGCCTTGAGG + Intronic
1192672554 X:73161244-73161266 CTGTCTTTGCTGAGCCACCTGGG + Intergenic
1193329960 X:80224502-80224524 CTCTCTGTGCTGTGCTACCTTGG + Intergenic
1194950545 X:100120801-100120823 TTGGCTGTGCTGAGGCACTTAGG - Intergenic
1194975946 X:100396185-100396207 GTGGCAGTGCTGTGGCTCTTAGG - Intronic
1195066434 X:101242288-101242310 CTCTGTCTGCTGTGGCACTTGGG + Intronic
1195988925 X:110663482-110663504 CTGTCCTTGCTGTGTGACTTTGG - Intergenic
1197482140 X:127000399-127000421 CTTTCAGTGCTGTTGCACTGGGG + Intergenic
1197839272 X:130728166-130728188 CTGTGTGTGCTGTGGGAACTGGG - Intronic
1198549310 X:137727922-137727944 AAGTCTGTAATGTGGCACTTAGG + Intergenic
1198683969 X:139208338-139208360 CTCTCTGTGCCTTGTCACTTTGG + Intronic