ID: 1189998430

View in Genome Browser
Species Human (GRCh38)
Location X:46661614-46661636
Sequence CCCGGCCACATGGTGTTATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 66}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189998430_1189998437 5 Left 1189998430 X:46661614-46661636 CCACATAACACCATGTGGCCGGG 0: 1
1: 0
2: 0
3: 6
4: 66
Right 1189998437 X:46661642-46661664 CAGTTGGCAGCAGCTAGCTGGGG 0: 1
1: 0
2: 0
3: 15
4: 205
1189998430_1189998436 4 Left 1189998430 X:46661614-46661636 CCACATAACACCATGTGGCCGGG 0: 1
1: 0
2: 0
3: 6
4: 66
Right 1189998436 X:46661641-46661663 GCAGTTGGCAGCAGCTAGCTGGG 0: 1
1: 0
2: 1
3: 15
4: 151
1189998430_1189998435 3 Left 1189998430 X:46661614-46661636 CCACATAACACCATGTGGCCGGG 0: 1
1: 0
2: 0
3: 6
4: 66
Right 1189998435 X:46661640-46661662 AGCAGTTGGCAGCAGCTAGCTGG 0: 1
1: 0
2: 1
3: 20
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189998430 Original CRISPR CCCGGCCACATGGTGTTATG TGG (reversed) Intronic
902600866 1:17539628-17539650 CCCGGCCACCAGGGGTTAAGCGG + Intergenic
910826284 1:91410964-91410986 CCTGGCAACATGTTGTTCTGAGG - Intergenic
914753951 1:150552739-150552761 CTCGGCCTCTTGGTGTTATGAGG - Intronic
918378786 1:183934476-183934498 CACGCCCACATGATGTTTTGTGG - Intronic
923858607 1:237870820-237870842 CCCAGCCACATGCTGTAAAGTGG - Intergenic
1082847874 11:57741134-57741156 AGCGGCCACATGTTGTTAGGTGG + Intronic
1084215504 11:67645115-67645137 CCCAGCCACAGGGTGTGCTGCGG - Exonic
1089351777 11:117825383-117825405 CCAGGCCAAATGGTGGTAGGAGG - Intronic
1091763452 12:3102975-3102997 CCAGGCCACTTGCTGTTAGGTGG + Intronic
1091883527 12:3999366-3999388 CCTGGCCACATGGTGGGATTAGG - Intergenic
1102891756 12:116564721-116564743 CCAGGCAAGATGGTGTTATATGG - Intergenic
1105334299 13:19450846-19450868 TCCTGCCAGATTGTGTTATGAGG - Intronic
1105860626 13:24408514-24408536 TCCTGCCAGATTGTGTTATGAGG + Intergenic
1107097081 13:36548511-36548533 ACCGGACACATGGAGTAATGCGG - Intergenic
1108628677 13:52258210-52258232 TCCTGCCAGATTGTGTTATGAGG - Intergenic
1108657380 13:52548240-52548262 TCCTGCCAGATTGTGTTATGAGG + Intergenic
1121344412 14:93124783-93124805 CCTGGCCAGGTGGTGTAATGTGG + Intergenic
1122393065 14:101403561-101403583 TCCGGCCACATGGAGCTCTGTGG - Intergenic
1127861108 15:62994882-62994904 CCCGGGCAAATGGTGTTAAGGGG + Intergenic
1130637887 15:85642546-85642568 CCCCGCCCCATGGCGTTAGGGGG + Intronic
1131006959 15:88986210-88986232 TCCGAACACATGGTGTTATCTGG + Intergenic
1133778277 16:8915437-8915459 CGCGGCAAAATGGTGGTATGTGG - Exonic
1133905168 16:10015825-10015847 CCCTACCACATGGTTTAATGAGG - Intronic
1141752867 16:85970743-85970765 ACCTATCACATGGTGTTATGAGG + Intergenic
1142905694 17:3040231-3040253 CCCCGGCACATGGTGTATTGAGG + Intergenic
1143538391 17:7555471-7555493 CCAGGCCACACGGTGGCATGTGG + Intronic
1151913946 17:77103817-77103839 CCCGGCTCCATGGGGTTATGAGG + Intronic
1155206692 18:23564441-23564463 CCCAGCCACATGGTTATCTGAGG - Intronic
1163119751 19:15210358-15210380 CCCGGCCACATGGAGTACAGGGG + Intergenic
1164052158 19:21592839-21592861 CCCAGGCACAGGGTGTTCTGTGG - Intergenic
1166268005 19:41696840-41696862 CCCGGCCATCTGGTTCTATGGGG - Intronic
1166997740 19:46727886-46727908 CCCGGCCACATGAAGGTAAGAGG - Exonic
1168027465 19:53653099-53653121 CAGGGCCACATGGTATTAGGAGG - Intergenic
933784414 2:85827565-85827587 CCGCGCCACCTGGTGTTGTGAGG - Intergenic
934717168 2:96550788-96550810 CGCGGCCACAGGGAGTTGTGGGG - Intronic
937342205 2:121098514-121098536 CCCAGACACAGGGTGTCATGTGG - Intergenic
941822587 2:169857361-169857383 CCCGGCCCCATTGTGTTCTGAGG + Intronic
1175416888 20:58807374-58807396 CCCGGCCCCATGTTGTTATTTGG + Intergenic
1175433715 20:58927650-58927672 CCCTGCCATATGGGGTTAGGTGG - Intergenic
1175645920 20:60671590-60671612 CCCGACCCCGTGGTGTGATGGGG - Intergenic
1182319112 22:29466734-29466756 CCAGGCAACATGGTGAGATGGGG + Intergenic
1185052052 22:48559169-48559191 CCCGGGGCCATGGTGTTTTGTGG + Intronic
956838187 3:73112821-73112843 CCCGTCCAGATGGCGTTATCAGG - Intergenic
961475099 3:127141185-127141207 CCTGGCCACAAAGAGTTATGAGG - Intergenic
962789017 3:138793888-138793910 CCAGGCCACGTAGTGTTCTGTGG + Intronic
966930892 3:184674806-184674828 CCCGGCTACACTGTGTGATGGGG - Intronic
969298983 4:6286247-6286269 CCCAGTCCCATGGTGTTAGGAGG + Intronic
978205936 4:106081472-106081494 CACGGCCACATGGTGGTGAGGGG + Intronic
982219687 4:153113913-153113935 CCAGGCCACTTGGTGCTCTGTGG + Intergenic
991091348 5:62696613-62696635 CCCAGCCAGATTGTTTTATGTGG + Intergenic
996202510 5:120694050-120694072 CCTGCCAACATGTTGTTATGAGG + Intergenic
999719204 5:154386251-154386273 CCTGGCCACATGCTCTCATGTGG - Intronic
1000273153 5:159706081-159706103 CTCCTCCACATGGTGTTATCTGG + Intergenic
1001050395 5:168409397-168409419 GCTGGACACATGGTGGTATGGGG - Intronic
1005028010 6:21482574-21482596 CCCTACCACATGCTGTAATGGGG - Intergenic
1027632475 7:80623725-80623747 CCAGGATACATGTTGTTATGTGG + Intronic
1030142673 7:106320910-106320932 CCCGGCCACCTGGCCATATGAGG - Intergenic
1030275921 7:107721682-107721704 GCCAGCCACATGGTGTAAGGAGG + Intergenic
1031564993 7:123285188-123285210 CGCCCCCACATGGTGTGATGGGG - Intergenic
1036510728 8:9397759-9397781 CCCTGCAACATGGTGATAGGTGG - Intergenic
1041506415 8:58603370-58603392 CTCCGCCACATGGTGCTCTGGGG + Exonic
1049241611 8:141540259-141540281 CCAGGCCACAGGGTGTTAGTGGG - Intergenic
1055641401 9:78321269-78321291 CCCAGGCACTTGGTGTTCTGTGG + Intronic
1057034750 9:91803766-91803788 CAAGGCCACATGCTGTCATGAGG - Intronic
1058108392 9:101002256-101002278 CCCGTCAACATGTTGTAATGTGG + Intergenic
1061386822 9:130295417-130295439 CCTGACCCCATGGTGTTCTGAGG + Intronic
1062440078 9:136565862-136565884 CCTGGCCACATGGTGATCTATGG + Intergenic
1186273714 X:7918261-7918283 CCCAGCCACATGGAATTGTGAGG - Intronic
1189496237 X:41511481-41511503 CCCAGCTACATGGGGTGATGAGG + Intergenic
1189998430 X:46661614-46661636 CCCGGCCACATGGTGTTATGTGG - Intronic
1197910533 X:131478813-131478835 CCCAGCCACATGGAGTCATGAGG + Intergenic
1200456915 Y:3405128-3405150 CCTGCACACATGGTGTTATCCGG + Intergenic
1202597500 Y:26557345-26557367 TCCTGCCAGATTGTGTTATGAGG + Intergenic