ID: 1189998435

View in Genome Browser
Species Human (GRCh38)
Location X:46661640-46661662
Sequence AGCAGTTGGCAGCAGCTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 209}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189998427_1189998435 20 Left 1189998427 X:46661597-46661619 CCACTAACTAGCTATCGCCACAT 0: 1
1: 0
2: 0
3: 4
4: 52
Right 1189998435 X:46661640-46661662 AGCAGTTGGCAGCAGCTAGCTGG 0: 1
1: 0
2: 1
3: 20
4: 209
1189998432_1189998435 -7 Left 1189998432 X:46661624-46661646 CCATGTGGCCGGGAACAGCAGTT 0: 1
1: 0
2: 0
3: 12
4: 123
Right 1189998435 X:46661640-46661662 AGCAGTTGGCAGCAGCTAGCTGG 0: 1
1: 0
2: 1
3: 20
4: 209
1189998430_1189998435 3 Left 1189998430 X:46661614-46661636 CCACATAACACCATGTGGCCGGG 0: 1
1: 0
2: 0
3: 6
4: 66
Right 1189998435 X:46661640-46661662 AGCAGTTGGCAGCAGCTAGCTGG 0: 1
1: 0
2: 1
3: 20
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189998435 Original CRISPR AGCAGTTGGCAGCAGCTAGC TGG Intronic
900403174 1:2481149-2481171 AGGAGCTGGCAGGAGCTGGCAGG - Intronic
900403176 1:2481159-2481181 AGCAGCTGGCAGGAGCTGGCAGG - Intronic
901248456 1:7752986-7753008 AGCAGAGGGCACCAGCTATCTGG - Intronic
902621574 1:17653945-17653967 AGCAGAGGGCAGCAGCTGCCTGG + Intronic
904861040 1:33537743-33537765 AGCAGGTGGAAGCACCTACCTGG - Intronic
905485303 1:38292021-38292043 AGCAGTTGGCCCCAGATTGCTGG + Intergenic
905925197 1:41744823-41744845 AGCACTTGGAAGCACCTGGCAGG - Intronic
907285304 1:53376143-53376165 AGCAGCTGCCAGCAGCCGGCCGG + Intergenic
908467632 1:64413669-64413691 AGCAGAAAGCAGCAGCTAGGAGG - Intergenic
908521450 1:64947036-64947058 GGTAGTTGGCAGGAGCTAGCAGG + Intronic
909206182 1:72760635-72760657 AAAAGTTGGCAGCATCTATCTGG - Intergenic
910222582 1:84903020-84903042 AGCAGGTTGCCGCTGCTAGCTGG - Intergenic
912646732 1:111399973-111399995 ACCAGGTGGCAGCAGTTATCAGG - Intergenic
913200255 1:116490376-116490398 CGCATTTTGCAGCAGCTAGTTGG - Intergenic
914419673 1:147517859-147517881 AGCGGGTTGCAGCAGCTGGCTGG + Intergenic
916963939 1:169916046-169916068 AGCAGTTGGAAGCACAAAGCAGG - Intergenic
919961372 1:202473413-202473435 AGCTGTTGGCATTTGCTAGCTGG + Intronic
920398858 1:205664744-205664766 GGCAGTTGGCGGCAGCAAGGAGG - Exonic
924578052 1:245298477-245298499 AGAGGTTGCCAGCAGCTAGAGGG + Intronic
1063203371 10:3807294-3807316 TGCAGTTGTCTCCAGCTAGCTGG + Intergenic
1063371719 10:5526665-5526687 AGGTGTTGCCAGCAGCTTGCAGG - Exonic
1068287986 10:54964024-54964046 AGGAGTTGGCAACAGGAAGCAGG + Intronic
1070268139 10:74924827-74924849 AGCAGTAGGAAGCATTTAGCTGG - Intronic
1070664612 10:78334169-78334191 AGCAGTAGGCAGCAGCTTGGGGG + Intergenic
1070855515 10:79605407-79605429 AGCAGCTAGCAGCAGCAAGGGGG - Intergenic
1071131166 10:82395123-82395145 ATGAATTGGCAGCAGCTATCTGG - Intronic
1072444783 10:95489653-95489675 AGCAGATGGCATCAGGTAGCAGG - Intronic
1074460959 10:113636375-113636397 AGGAGTTAGCAGCAGATAGGAGG - Intronic
1075322773 10:121505556-121505578 AGCAAATGGCAGAAGCAAGCGGG + Intronic
1075856175 10:125631999-125632021 AGAAGATGGCAGCAGAAAGCTGG + Intronic
1076065491 10:127444650-127444672 GGCAGTTGGCAACAGCTAAGGGG + Intronic
1076069303 10:127473656-127473678 GGCAGTAGGCAGAAGCTAGAAGG + Intergenic
1076421075 10:130331935-130331957 AGCAGTTGGGAGCAAATAGGGGG - Intergenic
1077105301 11:839566-839588 AGCAGTGGGCAGAGGCCAGCAGG + Intronic
1080147011 11:28998156-28998178 TTCAGTTAGCAGCAGCTAGCAGG - Intergenic
1080750274 11:35144324-35144346 AGCAGGTGGCAGATGCTACCAGG + Intronic
1081634181 11:44709828-44709850 AGGAGATGGGGGCAGCTAGCAGG + Intergenic
1081713656 11:45233763-45233785 GGCAGGGGGCATCAGCTAGCAGG + Intronic
1083315829 11:61814640-61814662 AGCGGGTTGCAGCAGCTGGCTGG + Intronic
1083391825 11:62357021-62357043 CGCAGTTTGCAGCAGCTATGGGG + Exonic
1083636214 11:64122397-64122419 GGAAGATGGCAGCAGCTAGGAGG + Intronic
1084654175 11:70505639-70505661 AGCGGGTGGCAGGAGCAAGCAGG - Intronic
1084911468 11:72392967-72392989 AGCAGGTCATAGCAGCTAGCTGG + Intronic
1085959160 11:81439106-81439128 AGCAGTGGGGTACAGCTAGCTGG + Intergenic
1087874752 11:103342399-103342421 AGCAGCTTGCTGCAGCTGGCTGG - Intronic
1091435609 12:470426-470448 AGCAGTCGGGACCAGCTGGCTGG - Intronic
1101961689 12:109255730-109255752 AGCTGCAGCCAGCAGCTAGCAGG + Intronic
1104943369 12:132405039-132405061 AGCAGATGGCAGCAGCTGCAGGG + Intergenic
1117181626 14:53197805-53197827 GAGAGGTGGCAGCAGCTAGCAGG + Intergenic
1119322383 14:73739632-73739654 AGCAGCTGGCAGCAGCAGCCAGG - Exonic
1122623955 14:103074887-103074909 AGCAGCTGGCAGCCTCCAGCTGG - Intergenic
1123067913 14:105627506-105627528 AGCAGTTGGCAAGGGCGAGCTGG - Intergenic
1123091593 14:105744507-105744529 AGCAGTTGGCAAGGGCGAGCTGG - Intergenic
1123097362 14:105772848-105772870 AGCAGTTGGCAAGGGCGAGCTGG - Intergenic
1125425037 15:39540099-39540121 AGCTGTTTGGAGTAGCTAGCTGG + Intergenic
1126173010 15:45709690-45709712 AGCAGCAGGCAGCAGGCAGCAGG + Intergenic
1126258725 15:46660389-46660411 AGCAGTTAGAAGCAGCTAAGAGG + Intergenic
1128680889 15:69650554-69650576 AGAGGTGGGCAGCAGCTAGACGG - Intergenic
1129742476 15:77996149-77996171 GGCAGTTGTCAGCAGCTGCCGGG - Exonic
1129843007 15:78755328-78755350 GGCAGTTGTCAGCAGCTGCCGGG + Intergenic
1131305888 15:91242945-91242967 AGCAGTTGGCTGAAGTTAGGTGG + Intronic
1132196979 15:99921668-99921690 AGCGGTTGGCAGGAGCTGGGAGG + Intergenic
1134028949 16:10976713-10976735 AGCAGTTAGCAACAGCATGCTGG - Intronic
1135075662 16:19391277-19391299 AGCAGGTTGCAGCTGCTGGCTGG + Intergenic
1137062617 16:35805388-35805410 AGGAGATGGCAGAAGTTAGCTGG - Intergenic
1139909849 16:70391074-70391096 AGTGGCTGGCACCAGCTAGCTGG + Intronic
1141617894 16:85220616-85220638 AGCAGCGGGCAGCAGCGGGCAGG - Intergenic
1142003235 16:87675975-87675997 AGCTGTTGGCAGGAGCTGGGAGG + Intronic
1142746024 17:1958701-1958723 GGCAGCTGGCAGCAGCGTGCGGG + Intronic
1143741722 17:8959240-8959262 AGCTGTTGTCAGAAGCAAGCTGG - Intronic
1144308300 17:13989423-13989445 AGCACTTGCCAGAAGCTGGCTGG - Intergenic
1144771771 17:17763446-17763468 AGCTGCTGGCAGCAGCAAGAGGG + Intronic
1145014097 17:19385645-19385667 AGCAGTTGCCAGCACCCACCTGG + Intronic
1145919516 17:28599781-28599803 AGCAGAAGGCAGGAGCTGGCGGG - Intronic
1147920632 17:43914658-43914680 AGCTCTTGACAGCAGCTGGCAGG + Intergenic
1148667720 17:49387256-49387278 ACCAGTTTGCAGCGGCCAGCAGG - Intronic
1149025259 17:52019488-52019510 AGCAGTTTTCAGCAGATAGAAGG + Intronic
1151847317 17:76665918-76665940 AGCAGTTAGCAGCAGTTAAAAGG - Intergenic
1153073306 18:1131817-1131839 AGCAGTTGGCAACAGCTGGGGGG - Intergenic
1158119395 18:54031459-54031481 GGCAGTTGCCAGGAGCTGGCAGG + Intergenic
1160896750 19:1406605-1406627 AGCAGTAGGCAGCACGTACCCGG + Intergenic
1161168463 19:2801234-2801256 TTCAGTTGGCATCAGCCAGCTGG + Intronic
1161390362 19:4017332-4017354 AGCAGGAGGCTGCAGCCAGCGGG - Intronic
1161803072 19:6426424-6426446 AGCAGGTGGCATCAGCTATGTGG - Exonic
1162452784 19:10764792-10764814 AGCAGTGGGAACCAGCAAGCTGG - Intronic
1164595098 19:29527005-29527027 AGCAGTAGGCAGCCGATGGCCGG + Intronic
1164676254 19:30103778-30103800 AGCAGTTGGCAGCATTTGGAAGG - Intergenic
1166523310 19:43495540-43495562 AGCAGATGGCAGCCGAGAGCCGG - Exonic
1167671306 19:50855241-50855263 AGCAGCTGGGAGCAGGGAGCTGG - Intronic
927860752 2:26558605-26558627 AGCAGCGGGAAGGAGCTAGCCGG + Exonic
929879898 2:45826554-45826576 GGTAGTTGGCAGCAGATAGATGG - Intronic
933447701 2:82403133-82403155 AGCAGGTTGCAGCTGCTGGCTGG - Intergenic
933483813 2:82893061-82893083 AACAGATGGCAGCAGCTTTCAGG + Intergenic
933919383 2:87029196-87029218 AGCAGTTGTCAGCAGATAGGTGG + Intergenic
934003611 2:87740711-87740733 AGCAGTTGTCAGCAGATAGGTGG - Intergenic
934142644 2:89062882-89062904 AGCAGTGGGCAGCAGCAATTGGG - Intergenic
934226600 2:90137672-90137694 AGCAGTGGGCAGCAGCAATTAGG + Intergenic
935084587 2:99832495-99832517 AGCTGTTGGCCACAGCTTGCAGG + Intronic
937236729 2:120435774-120435796 GGCAGTTGGCGTCAGCCAGCTGG + Intergenic
938196081 2:129329659-129329681 AGCAGGTTGCAGCTGCTGGCTGG - Intergenic
940502728 2:154514698-154514720 AGCAGTTGGGGGCAGCAAGGGGG + Intergenic
942317457 2:174708966-174708988 AGCAGTTTGCCACTGCTAGCTGG + Intergenic
943623341 2:190173940-190173962 AGCAGGTGACAGAAGCTAGGAGG - Intronic
944290165 2:197995780-197995802 AGCAGATACCAGCAGCCAGCTGG - Intronic
944290321 2:197997251-197997273 AGCAGATACCAGCAGCCAGCTGG - Intronic
946084690 2:217158645-217158667 AGCAGCTGGCAGGGGATAGCAGG + Intergenic
946374919 2:219302261-219302283 AGGAGTTGCCAGCACCCAGCAGG - Exonic
946445623 2:219737645-219737667 AGAAGTTGGCTGGAGCCAGCTGG + Intergenic
947202619 2:227628464-227628486 ATCAGGTGGCAGCATCTGGCTGG + Exonic
947793982 2:232882938-232882960 AGCAAGTGGCAGCAGGGAGCAGG + Intronic
948978870 2:241482422-241482444 AGCAATTGCCAGCAGCTCACAGG + Intronic
1169534763 20:6525928-6525950 AGCAGTTGGCTGTAGATGGCAGG + Intergenic
1170856483 20:20060879-20060901 AGCTGGTGGCAGTTGCTAGCGGG - Intronic
1171361404 20:24588876-24588898 AGCAGTAGGCTGGAGCTAGCAGG + Intronic
1173190035 20:40869210-40869232 AGCATTTGGCAGCTTCTATCAGG - Intergenic
1173254785 20:41386696-41386718 TGCAGTTGGCAGCACATAGTAGG + Intergenic
1173895301 20:46546228-46546250 AGCAGCTGGCCACAGCTGGCTGG + Exonic
1174347131 20:49938415-49938437 AGCAGTCGGTTGGAGCTAGCGGG - Intronic
1174980752 20:55391989-55392011 AGATTTTGGTAGCAGCTAGCAGG - Intergenic
1175477976 20:59290320-59290342 AGCAGCTGCCAGCATCTGGCTGG - Intergenic
1176179012 20:63740954-63740976 AGCAGCCGGCAGCAGCCAGGGGG - Intronic
1177094510 21:16815891-16815913 CTCAGTGGTCAGCAGCTAGCAGG + Intergenic
1177616270 21:23524975-23524997 GGCAGTTGACCGCATCTAGCTGG - Intergenic
1179895383 21:44358961-44358983 AGCAGTTTGCCGCTGCTGGCTGG + Intronic
1179921897 21:44512048-44512070 GGGAGTTGGCAGCAGGAAGCAGG + Intronic
1181082423 22:20424207-20424229 AGCTGTTGGTGGCAGCTTGCGGG - Intergenic
1181805854 22:25374115-25374137 AGCAATGGGCTGCAGCCAGCGGG - Intronic
1182860395 22:33554642-33554664 AAGAGTTGGCAGCAGGTAGGAGG - Intronic
1183187699 22:36301475-36301497 AGCAGGTGGCAGCACCAGGCAGG + Intronic
1183370360 22:37428318-37428340 TGCAGGTGGCAGCAGGTGGCAGG - Intergenic
949285917 3:2404340-2404362 AGCTGTTGGCAGAATCCAGCAGG + Intronic
950706243 3:14784299-14784321 TGCAGCTGGCAGGAGCTGGCTGG - Intergenic
954372441 3:50175951-50175973 AGGAGGTGGCAGCAGGTGGCAGG - Intronic
954997563 3:54895606-54895628 AGCAGTTTGCAGCAGAGAGTTGG - Intronic
955204748 3:56885665-56885687 AGCAGGTGGCAGTATCTGGCAGG - Intronic
958685927 3:97394111-97394133 AGCAGTTGGCTGCAAATAGATGG - Intronic
960484870 3:118239449-118239471 GGCAGCTGGCAGCAGATAGCAGG - Intergenic
960953274 3:123013325-123013347 AGCAGTTTGCAGAAGCGGGCGGG - Intronic
961007342 3:123413826-123413848 AGCAAATGGCAGCAGAGAGCTGG + Intronic
961102695 3:124215086-124215108 AGCAGCTGCCAGCAGTTGGCAGG - Intronic
961643372 3:128379143-128379165 GGGGGTTGGCAGCAGCTAGCTGG - Intronic
961884144 3:130084770-130084792 AGGAGTTGGCAGAAGCTGGGAGG - Intronic
963472332 3:145755964-145755986 AGCGGTTTTCAGGAGCTAGCAGG + Intergenic
963657904 3:148082707-148082729 AGCATTTGGCAGAGGCAAGCAGG - Intergenic
964138226 3:153369318-153369340 AGCAGGTTCCAGCTGCTAGCTGG + Intergenic
964450402 3:156807119-156807141 AGAAGTTGGCAGCAGGTAAAGGG - Intergenic
965583340 3:170292743-170292765 AGCAGTTGCCAACATATAGCCGG + Intronic
967127088 3:186434242-186434264 AGGAGTTGCCAGGAGCTAGCGGG - Intergenic
968417544 4:453183-453205 AAAAGGTGGAAGCAGCTAGCTGG + Intronic
968461234 4:726049-726071 AGCAGTGGGCAGCCGCGGGCGGG + Intronic
969280164 4:6165423-6165445 ACCGCTTGGTAGCAGCTAGCTGG - Intronic
975849532 4:78557553-78557575 AGCATTTGGCATCAGATAGCAGG + Intronic
976397543 4:84572416-84572438 GGCAGGTGGCAGCAGGAAGCCGG - Intergenic
981704032 4:147640513-147640535 GGCAGTTAGCAGCATGTAGCTGG - Intronic
984655166 4:182309525-182309547 AGCAGTAGGCAGACGCTGGCAGG - Intronic
985107656 4:186514772-186514794 AGCAGATGGCAGAGGCTGGCTGG - Intronic
986557869 5:9029309-9029331 AGTAGTTGTCAGCAACTAGGGGG + Intergenic
989069516 5:37496234-37496256 AGCAGGTGGCGGCAGCTGGCTGG - Intronic
989191827 5:38677776-38677798 TGCTGTTGGCAGCAGCTTGCTGG - Intergenic
992159040 5:73982940-73982962 AGCAGCTGGCAGGAGGTGGCGGG - Intergenic
992384086 5:76266975-76266997 GGGAGGTGGCACCAGCTAGCAGG + Intronic
994756229 5:103797062-103797084 AGCAGGTTGCCGCTGCTAGCTGG + Intergenic
999006809 5:147990164-147990186 AGTGGTTGCCAGCAGCTAGGAGG + Intergenic
999648141 5:153739133-153739155 AGGAGTTTGCAGCAGCAAGGTGG - Intronic
1001105465 5:168850036-168850058 AGCATTTGTCTGCTGCTAGCTGG + Intronic
1001600540 5:172925534-172925556 AGCAGTGGGCAGCAGCGGGGTGG - Intronic
1001754673 5:174159332-174159354 AGCTGGTGGCAGCAGCCAGATGG + Intronic
1003119740 6:3309618-3309640 AGCAGGTGGCAGGAGGCAGCGGG + Intronic
1005968748 6:30744630-30744652 AGCGGTTGGCAGCAGCGGGCTGG + Intergenic
1007030835 6:38624282-38624304 AGCAGGTTGCAGCTGCTGGCTGG - Intronic
1011346310 6:86372756-86372778 GGCAGTTGGGACCATCTAGCGGG - Intergenic
1014653413 6:124069741-124069763 GGCAGGTGGCACCTGCTAGCAGG - Intronic
1014819967 6:125977227-125977249 AGCAGTTGCCAGGAGTTAGAGGG - Intronic
1015413660 6:132923291-132923313 ATCACTTGACAGCAGCTAGTAGG - Intergenic
1015420237 6:132999226-132999248 AGCAGATGACAGCAAATAGCAGG + Intergenic
1015703784 6:136065117-136065139 AGGACTTGACAGCAGCTACCTGG + Intronic
1016045324 6:139474914-139474936 AGCAGTCAGGAGCAGCTGGCTGG + Intergenic
1017881921 6:158568021-158568043 AGGTGATGGCAGCAGCTGGCAGG + Intronic
1018127393 6:160694872-160694894 AGCAGTTGTCAGCAGATAGGTGG - Intergenic
1020617475 7:10477040-10477062 TCCAGGTGGCAGCAGGTAGCAGG + Intergenic
1022098273 7:27154388-27154410 AGCAGTCGGCACTAGGTAGCAGG + Exonic
1022227254 7:28376038-28376060 AGCAGTTGGGAGAAGCTGGAAGG - Intronic
1022494692 7:30845576-30845598 AGCAGATGGCAGCTGATGGCAGG - Intronic
1024803888 7:53113615-53113637 AGCAGTTGACAGCAGTGAGCCGG + Intergenic
1026165693 7:67907217-67907239 AGCAGCTGGCATCAGCTTCCTGG - Intergenic
1027503881 7:78990507-78990529 AATAGATGGCAGCAGCTAGAAGG - Intronic
1027634420 7:80652577-80652599 AGCAAATGGTAGCAGCTAGTGGG + Intronic
1027872956 7:83732583-83732605 AGCAGCTGGCAGCAGTCAGAGGG + Intergenic
1030068392 7:105678011-105678033 GGCAGTTGGCAGCGGCAAACAGG + Intronic
1033047426 7:137975390-137975412 ATCAGTTGGCTGCAGCTCCCAGG + Intronic
1033474752 7:141681173-141681195 AGCAGTTGGCAGTAGAATGCTGG + Intronic
1034734594 7:153416805-153416827 TGCAGTTGGGAGCAACCAGCCGG + Intergenic
1034989996 7:155542274-155542296 AGCAGCTGGCAGGACCAAGCAGG - Intergenic
1036215630 8:6877637-6877659 TGCAGTTGGCAGAAGGCAGCAGG - Intronic
1036674554 8:10819120-10819142 AGCAGATGGAAGCAGCAGGCTGG - Intronic
1037884731 8:22589956-22589978 AGTAGTGGGCAGTAGCCAGCTGG + Intronic
1037898334 8:22673157-22673179 AGCAGGTGGCAGCACCGGGCAGG + Intergenic
1038442365 8:27580321-27580343 AGCAGTTGCCAGGGGCTAGGAGG - Intergenic
1040447165 8:47507145-47507167 AGGAGCTGGCAGCAGGTGGCTGG - Intronic
1041132864 8:54721404-54721426 AGCAGTGGGAAATAGCTAGCAGG + Intergenic
1041846631 8:62336551-62336573 AGCAGTGGACAGAAGCTAGAAGG - Intronic
1042227044 8:66522245-66522267 AGCACTGGGGAGCAGGTAGCTGG - Intergenic
1044090927 8:88000186-88000208 AGCAGTTGGCAGCAGAAAGCGGG - Intergenic
1044460354 8:92437377-92437399 AGCAATGGGCAGCAGCTAATAGG - Intergenic
1047922591 8:129650941-129650963 AGCAGTAGGCAGGAAATAGCAGG + Intergenic
1049004249 8:139844854-139844876 AGCAGGTTGCCGCAGCCAGCTGG - Intronic
1049276349 8:141721920-141721942 GGGATTTGGGAGCAGCTAGCTGG + Intergenic
1049360611 8:142210961-142210983 AGAAGGTGGCAGCAGCTCGGGGG + Intergenic
1049764141 8:144345506-144345528 AGAAGTTGGCAGCTGGAAGCGGG + Intergenic
1050456800 9:5842147-5842169 AGCAGGTTGCAGCTGCTGGCTGG + Intergenic
1054880928 9:70143881-70143903 ACCAGTTGACAGTAGCTAGACGG - Intronic
1055978125 9:81974147-81974169 AACTGTTGGCTGGAGCTAGCTGG + Intergenic
1056331654 9:85526079-85526101 AGCAGAAGACAGCAGCAAGCTGG + Intergenic
1056838786 9:89980839-89980861 AGGAGGTGGGAGCAGCTAACAGG + Intergenic
1057152694 9:92808901-92808923 AGCTGTTGCCAGCAGGTAGAGGG - Intergenic
1057803604 9:98205015-98205037 ACCAGTAGGAAGCAGCTACCTGG - Intronic
1059318154 9:113444924-113444946 GGCAGTTAGCAGCAGTTACCTGG - Exonic
1059731872 9:117064855-117064877 AGCAGTTGAAAGCATCTAGGTGG - Intronic
1059927651 9:119227462-119227484 AACAGTTGGATGCAGCTAGCTGG + Intronic
1061326365 9:129867183-129867205 AGCAGACCCCAGCAGCTAGCGGG - Intronic
1185626883 X:1488652-1488674 AGGAGTTTGCAGCAGGTACCTGG - Intronic
1189103997 X:38219014-38219036 AAAAGTTGGGAGCAGCTTGCAGG + Intronic
1189998435 X:46661640-46661662 AGCAGTTGGCAGCAGCTAGCTGG + Intronic
1190515044 X:51215224-51215246 AGGAGTTGGCAGCAGGGTGCAGG + Intergenic
1191165587 X:57386844-57386866 ACCTGTTGGCATCAGGTAGCAGG + Intronic
1192498442 X:71632384-71632406 AGCATCTGGCAGCTGCTGGCTGG + Intergenic
1193522012 X:82542021-82542043 AGCAGTTGGCTGCAGGTATGTGG - Intergenic
1193847205 X:86487472-86487494 AGCATTTTGCACCAGCTAGGTGG + Intronic
1195688086 X:107603264-107603286 AGCAGGTGGCAGCAGCTGCAGGG + Exonic
1196055056 X:111346529-111346551 AGAAGTTGCCAGCAGCTAGTGGG + Intronic
1198627346 X:138591815-138591837 AGCAGTTGGCAGCCACTGGAGGG - Intergenic