ID: 1189998436

View in Genome Browser
Species Human (GRCh38)
Location X:46661641-46661663
Sequence GCAGTTGGCAGCAGCTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189998432_1189998436 -6 Left 1189998432 X:46661624-46661646 CCATGTGGCCGGGAACAGCAGTT 0: 1
1: 0
2: 0
3: 12
4: 123
Right 1189998436 X:46661641-46661663 GCAGTTGGCAGCAGCTAGCTGGG 0: 1
1: 0
2: 1
3: 15
4: 151
1189998427_1189998436 21 Left 1189998427 X:46661597-46661619 CCACTAACTAGCTATCGCCACAT 0: 1
1: 0
2: 0
3: 4
4: 52
Right 1189998436 X:46661641-46661663 GCAGTTGGCAGCAGCTAGCTGGG 0: 1
1: 0
2: 1
3: 15
4: 151
1189998430_1189998436 4 Left 1189998430 X:46661614-46661636 CCACATAACACCATGTGGCCGGG 0: 1
1: 0
2: 0
3: 6
4: 66
Right 1189998436 X:46661641-46661663 GCAGTTGGCAGCAGCTAGCTGGG 0: 1
1: 0
2: 1
3: 15
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189998436 Original CRISPR GCAGTTGGCAGCAGCTAGCT GGG Intronic
901656336 1:10771922-10771944 GGGCTTGGCAGCAGCTAACTGGG - Intronic
902387088 1:16082257-16082279 GCAGCTGCCAGCAGCACGCTGGG + Intergenic
904861039 1:33537742-33537764 GCAGGTGGAAGCACCTACCTGGG - Intronic
905485304 1:38292022-38292044 GCAGTTGGCCCCAGATTGCTGGG + Intergenic
905891074 1:41518693-41518715 GCAGTGCACAGCAGCTAGGTGGG + Intronic
907331066 1:53672043-53672065 GCAGTTGGCCACAACCAGCTTGG - Intronic
910222581 1:84903019-84903041 GCAGGTTGCCGCTGCTAGCTGGG - Intergenic
914419674 1:147517860-147517882 GCGGGTTGCAGCAGCTGGCTGGG + Intergenic
919506968 1:198411146-198411168 GCAGTTGGCAGAAAATAGATAGG + Intergenic
923934584 1:238746951-238746973 GCAGTTGACAGCAGAAAGGTAGG + Intergenic
1063148605 10:3318242-3318264 GCAGTGGGCAGCAGCGGGGTAGG + Intergenic
1063148640 10:3318379-3318401 GCAGTGGGCAGCAGCGGGGTAGG + Intergenic
1063148712 10:3318652-3318674 GCAGTGGGCAGCAGCGGGATAGG + Intergenic
1064367013 10:14717373-14717395 CCAGTAGGCATCAGCAAGCTGGG + Intronic
1064375142 10:14788704-14788726 GCAGTTGGCAGCCTCTTCCTAGG - Intergenic
1064602922 10:17011597-17011619 GCAGGTTGCCGCTGCTAGCTCGG + Intronic
1065370014 10:24974654-24974676 TCAGTTGTCATCAGCTTGCTTGG + Intergenic
1067774600 10:49153935-49153957 GCAGATGGCTGCAGCCAGCCAGG - Intergenic
1072486438 10:95860812-95860834 GCAGTAGGCAGCTGCTGGCATGG + Intronic
1073380227 10:103072584-103072606 GCAGTCGGCAGCAGCGGGATAGG - Intronic
1073921677 10:108466404-108466426 GCAGCTGGCGGCCGCTCGCTGGG + Intergenic
1074087253 10:110217828-110217850 GCACTTGTCAGCAGCTCTCTTGG - Intronic
1075256020 10:120926612-120926634 GCAGTGGAGAGCAGCCAGCTGGG + Intergenic
1076831349 10:132995991-132996013 GCAGTGGGCAGCAGAGACCTCGG + Intergenic
1078465683 11:11548459-11548481 GCAGGGGTCAGAAGCTAGCTGGG - Intronic
1079097846 11:17522506-17522528 GCAGTAGGCTCTAGCTAGCTAGG - Intronic
1083315830 11:61814641-61814663 GCGGGTTGCAGCAGCTGGCTGGG + Intronic
1083391826 11:62357022-62357044 GCAGTTTGCAGCAGCTATGGGGG + Exonic
1083636215 11:64122398-64122420 GAAGATGGCAGCAGCTAGGAGGG + Intronic
1084911469 11:72392968-72392990 GCAGGTCATAGCAGCTAGCTGGG + Intronic
1085710236 11:78823007-78823029 GCTGTTGGCAGCAGCGCTCTCGG + Intronic
1085959161 11:81439107-81439129 GCAGTGGGGTACAGCTAGCTGGG + Intergenic
1087874751 11:103342398-103342420 GCAGCTTGCTGCAGCTGGCTGGG - Intronic
1098524443 12:71470319-71470341 TGACTTGGCAGCAGCTAACTAGG + Intronic
1100076142 12:90786072-90786094 GCAGGTTGCAGCTGCTGGCTTGG - Intergenic
1100241981 12:92718810-92718832 GCAGTTGCCAGCAGTTACCATGG + Intergenic
1101730696 12:107424801-107424823 GGAGCTGGGAGGAGCTAGCTTGG - Intronic
1101745031 12:107533353-107533375 CCTGTGGGCAGCACCTAGCTGGG - Intronic
1102300618 12:111768301-111768323 GCTGTTGAAAGCAGCTGGCTAGG - Intronic
1102619470 12:114182576-114182598 GCAGTTGGCAGCGGGTGGGTGGG + Intergenic
1104198895 12:126568028-126568050 GCAGGTTGTAGCAGCTGGCTTGG - Intergenic
1109269594 13:60239651-60239673 ACAGAAGGCAGCAGCTACCTAGG + Intergenic
1109534080 13:63693748-63693770 GCAGTTTGCGGCACCTAGCCAGG + Intergenic
1110302535 13:73945994-73946016 GAGGTTGGCAGCAGCCAGCTTGG + Intronic
1119171191 14:72537473-72537495 CCAGTTGTCAGCAGCTCTCTGGG + Intronic
1122623954 14:103074886-103074908 GCAGCTGGCAGCCTCCAGCTGGG - Intergenic
1123067912 14:105627505-105627527 GCAGTTGGCAAGGGCGAGCTGGG - Intergenic
1123091592 14:105744506-105744528 GCAGTTGGCAAGGGCGAGCTGGG - Intergenic
1123097361 14:105772847-105772869 GCAGTTGGCAAGGGCGAGCTGGG - Intergenic
1123699282 15:22902697-22902719 GCAGGTGGCAGCACCTGGCTTGG - Intronic
1127816729 15:62617232-62617254 GCAGAAGGCAGAAGTTAGCTAGG + Intronic
1128562913 15:68680195-68680217 GCAGCTGGCAGCATGTGGCTGGG + Intronic
1129652993 15:77504739-77504761 GAAGTTGGCAGCAGAGAACTGGG + Intergenic
1129741818 15:77992949-77992971 GCAGCTGGCAGCAGCCCACTAGG - Intronic
1130412113 15:83655579-83655601 GCAGTAGGCAGCGGCAACCTGGG + Intronic
1130729093 15:86472073-86472095 GGAGCTGGCAGCAGCAAGGTAGG + Intronic
1134028948 16:10976712-10976734 GCAGTTAGCAACAGCATGCTGGG - Intronic
1135075663 16:19391278-19391300 GCAGGTTGCAGCTGCTGGCTGGG + Intergenic
1137062616 16:35805387-35805409 GGAGATGGCAGAAGTTAGCTGGG - Intergenic
1138253251 16:55525138-55525160 GCAGTAAGCAGGAGCTAGCAAGG - Intronic
1139909850 16:70391075-70391097 GTGGCTGGCACCAGCTAGCTGGG + Intronic
1141495370 16:84406150-84406172 ACCGATGGCAGCAGCTAGCAAGG - Intronic
1143741721 17:8959239-8959261 GCTGTTGTCAGAAGCAAGCTGGG - Intronic
1144705202 17:17363565-17363587 GCAGTAGGAATCAGCTAGCCCGG + Intergenic
1145014098 17:19385646-19385668 GCAGTTGCCAGCACCCACCTGGG + Intronic
1147557478 17:41488650-41488672 GAAGTCGTCAGCAGCCAGCTTGG + Exonic
1149993819 17:61396862-61396884 GCAGTGGGCAGCAGGAAGCTCGG - Intergenic
1152614101 17:81329995-81330017 GCAGGTGGCATCAGCTCTCTGGG + Intronic
1152678885 17:81655631-81655653 GCAGCTGACAGCAGCTCGATGGG - Intronic
1154175667 18:12086366-12086388 GCAGGTGGCAGCAGCCAGGGTGG + Intergenic
1159922406 18:74237807-74237829 ACAGATGGCAGCAGCGTGCTGGG - Intergenic
1160354773 18:78217587-78217609 GCAGTTGGGCGCAGCTAGCATGG + Intergenic
1162452783 19:10764791-10764813 GCAGTGGGAACCAGCAAGCTGGG - Intronic
1163170764 19:15529566-15529588 GCAGTTGGCTGCACCTCCCTGGG - Intronic
1165743401 19:38216838-38216860 GCAGTTGGGAGTGGCTGGCTGGG - Intronic
1166346704 19:42170863-42170885 GCATTTGGCTGAAGCTGGCTGGG - Intronic
926388155 2:12359279-12359301 TCTCTTGCCAGCAGCTAGCTTGG + Intergenic
926603513 2:14873046-14873068 GCAGGTGGCCGAGGCTAGCTCGG + Intergenic
929253515 2:39783696-39783718 CCAGGTAGGAGCAGCTAGCTTGG + Intergenic
933447700 2:82403132-82403154 GCAGGTTGCAGCTGCTGGCTGGG - Intergenic
933620407 2:84532431-84532453 GGAGTTGGCAGCAGCTAAACTGG + Intronic
933797196 2:85929127-85929149 GGACTTTGCAGCACCTAGCTTGG + Intergenic
933919384 2:87029197-87029219 GCAGTTGTCAGCAGATAGGTGGG + Intergenic
934003610 2:87740710-87740732 GCAGTTGTCAGCAGATAGGTGGG - Intergenic
934975200 2:98797295-98797317 GCAGGAGGGAGCAGCCAGCTGGG - Intronic
935016969 2:99192065-99192087 GGAGTTGGCAGCAGTTATCTCGG - Intronic
936269529 2:111038261-111038283 GCAGATGGTAGCAGCCTGCTGGG - Intronic
936648861 2:114403459-114403481 GCAGTTGTTAGAAGCCAGCTTGG + Intergenic
937734456 2:125272719-125272741 GCAGATGGCAGTAGTTTGCTAGG - Intergenic
938196080 2:129329658-129329680 GCAGGTTGCAGCTGCTGGCTGGG - Intergenic
942317458 2:174708967-174708989 GCAGTTTGCCACTGCTAGCTGGG + Intergenic
943942861 2:194021059-194021081 GCAGTTTGCCACAGCTGGCTCGG - Intergenic
944290164 2:197995779-197995801 GCAGATACCAGCAGCCAGCTGGG - Intronic
944290320 2:197997250-197997272 GCAGATACCAGCAGCCAGCTGGG - Intronic
1168827870 20:826070-826092 GCCATTGGCTGGAGCTAGCTGGG + Intergenic
1172276496 20:33682535-33682557 GCAGATGGCAGAAGCATGCTAGG - Intronic
1173922589 20:46757431-46757453 CCTGCAGGCAGCAGCTAGCTGGG + Intergenic
1175247247 20:57589604-57589626 GCAGTGGGCAGCAAGAAGCTGGG - Intergenic
1175575461 20:60057565-60057587 GCAGATGGCAGAAGCAAGCCAGG + Intronic
1179921898 21:44512049-44512071 GGAGTTGGCAGCAGGAAGCAGGG + Intronic
1180083896 21:45498845-45498867 GGAGATGGCAGCAGAGAGCTGGG + Intronic
1183370359 22:37428317-37428339 GCAGGTGGCAGCAGGTGGCAGGG - Intergenic
1184050625 22:42001389-42001411 GAAGTAGGCAGCAGGCAGCTCGG + Intronic
1184906122 22:47487939-47487961 GCAGGTTGCCGCTGCTAGCTTGG + Intergenic
950706242 3:14784298-14784320 GCAGCTGGCAGGAGCTGGCTGGG - Intergenic
951484404 3:23195824-23195846 CCAGTTGGCAGCAGCTAACTTGG - Intergenic
951709227 3:25572613-25572635 GCCATTGGCGGCATCTAGCTAGG + Intronic
960484869 3:118239448-118239470 GCAGCTGGCAGCAGATAGCAGGG - Intergenic
961007343 3:123413827-123413849 GCAAATGGCAGCAGAGAGCTGGG + Intronic
964138227 3:153369319-153369341 GCAGGTTCCAGCTGCTAGCTGGG + Intergenic
968520464 4:1032672-1032694 ACAGCTGCCAGCAGCTGGCTGGG + Intergenic
968617922 4:1588721-1588743 GCACTTGGGAGCAGCTAAGTTGG - Intergenic
974509148 4:62814717-62814739 TCATTTGGCAGCAGCTAATTAGG - Intergenic
979235273 4:118392887-118392909 GCAGGTTGCAGCTGCTGGCTAGG - Intergenic
988105345 5:26740014-26740036 GAAGGAGCCAGCAGCTAGCTTGG + Intergenic
989069515 5:37496233-37496255 GCAGGTGGCGGCAGCTGGCTGGG - Intronic
989456401 5:41649142-41649164 GCATTTGGCTGCAGTTAGCCTGG + Intergenic
994756230 5:103797063-103797085 GCAGGTTGCCGCTGCTAGCTGGG + Intergenic
997711168 5:136006005-136006027 GAAGTTGGGAGCAGCTTGGTAGG + Intergenic
999704169 5:154256214-154256236 GCAGTTGGCAGGAGCTAAGTTGG - Intronic
999966974 5:156820352-156820374 GCAGATGGCAGCAGGTGGCTTGG - Intergenic
1001105466 5:168850037-168850059 GCATTTGTCTGCTGCTAGCTGGG + Intronic
1001754674 5:174159333-174159355 GCTGGTGGCAGCAGCCAGATGGG + Intronic
1002552609 5:180007514-180007536 GAAGGTGGCAGCAGCTAGACTGG - Intronic
1002881281 6:1254645-1254667 CCAGTTGGCAGCAGCTCTCCCGG - Intergenic
1003082617 6:3033948-3033970 GCAGTTGGCAGCATGTAGTCTGG - Intergenic
1005899663 6:30206444-30206466 GCAGGAGGTAGCAGCCAGCTGGG + Intronic
1006056020 6:31385083-31385105 AGAGGTGGCAGCAGCTAGTTCGG + Intergenic
1007030834 6:38624281-38624303 GCAGGTTGCAGCTGCTGGCTGGG - Intronic
1016120875 6:140339927-140339949 GCAGTTGACAGCAGAAGGCTAGG - Intergenic
1017776445 6:157684710-157684732 GCGGTTTGCAGCAGCAAGCGAGG + Intergenic
1018127392 6:160694871-160694893 GCAGTTGTCAGCAGATAGGTGGG - Intergenic
1018149142 6:160922188-160922210 GCAGTTTTCAGCAGGTAGGTGGG + Intergenic
1022519015 7:30994122-30994144 GGAGTTTGCAGCACCTAGCCTGG + Intergenic
1022541257 7:31137352-31137374 GCAGGTTGCAGCCGCTGGCTTGG + Intergenic
1024748064 7:52430633-52430655 GCAGGTTGCTGCTGCTAGCTCGG + Intergenic
1028154345 7:87412529-87412551 GCGGCTGGCAGGATCTAGCTTGG - Intronic
1030320115 7:108157693-108157715 GGAGTAGGCAGCAGTTATCTGGG + Intronic
1036203317 8:6787058-6787080 GCAGTTGGCAGAAGCAGGCGTGG - Intergenic
1036674553 8:10819119-10819141 GCAGATGGAAGCAGCAGGCTGGG - Intronic
1037095145 8:14977272-14977294 GCTGGTGGCAGCTGCTAGCAAGG - Intronic
1037884732 8:22589957-22589979 GTAGTGGGCAGTAGCCAGCTGGG + Intronic
1039831740 8:41220943-41220965 GAAGTTGGCAGCCGCTGGCACGG - Intergenic
1039840042 8:41286548-41286570 GCAGTTGGCAGCAAGGAGCATGG - Intronic
1040447164 8:47507144-47507166 GGAGCTGGCAGCAGGTGGCTGGG - Intronic
1040985684 8:53291721-53291743 GCAGCTGGCAGCTGGCAGCTGGG - Intergenic
1041896087 8:62926260-62926282 GCAGTTGACAGCATCTTGCCAGG + Intronic
1042227043 8:66522244-66522266 GCACTGGGGAGCAGGTAGCTGGG - Intergenic
1045711314 8:104987928-104987950 TCAGCTGGCAGGAGCTGGCTGGG + Intronic
1046111305 8:109729322-109729344 GAAGTAAGCAGCAGATAGCTTGG + Intergenic
1047022029 8:120785373-120785395 TCTGCTAGCAGCAGCTAGCTGGG - Intronic
1049004248 8:139844853-139844875 GCAGGTTGCCGCAGCCAGCTGGG - Intronic
1049276350 8:141721921-141721943 GGATTTGGGAGCAGCTAGCTGGG + Intergenic
1050353610 9:4762964-4762986 GCTGGTGGCAGCAGACAGCTGGG + Intergenic
1050456801 9:5842148-5842170 GCAGGTTGCAGCTGCTGGCTGGG + Intergenic
1054734640 9:68738526-68738548 GCAGTTGGCATCACCTTCCTTGG + Intronic
1057188478 9:93072397-93072419 GCATTTGGCTGCAGCTGGCCAGG - Intronic
1058610697 9:106772227-106772249 GAAATTGGCTGTAGCTAGCTTGG - Intergenic
1059731871 9:117064854-117064876 GCAGTTGAAAGCATCTAGGTGGG - Intronic
1059927652 9:119227463-119227485 ACAGTTGGATGCAGCTAGCTGGG + Intronic
1061572462 9:131486179-131486201 ACAGGTGACAGCAGCTAGCCAGG + Exonic
1061919054 9:133772213-133772235 GCAGGTGGCAGGAGCTGTCTGGG - Intronic
1061959776 9:133982125-133982147 GCAGATGGCAGCAGTGAGCCAGG + Intronic
1189544984 X:42033506-42033528 AAATTTAGCAGCAGCTAGCTGGG + Intergenic
1189998436 X:46661641-46661663 GCAGTTGGCAGCAGCTAGCTGGG + Intronic
1190427653 X:50347717-50347739 TAAGGAGGCAGCAGCTAGCTTGG - Exonic
1194478482 X:94390128-94390150 GCAGGTGGCTGCTGCTGGCTTGG + Intergenic
1194878018 X:99213607-99213629 GCACTTGGCAGCAGATACCAAGG - Intergenic