ID: 1189998437

View in Genome Browser
Species Human (GRCh38)
Location X:46661642-46661664
Sequence CAGTTGGCAGCAGCTAGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 205}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189998432_1189998437 -5 Left 1189998432 X:46661624-46661646 CCATGTGGCCGGGAACAGCAGTT 0: 1
1: 0
2: 0
3: 12
4: 123
Right 1189998437 X:46661642-46661664 CAGTTGGCAGCAGCTAGCTGGGG 0: 1
1: 0
2: 0
3: 15
4: 205
1189998427_1189998437 22 Left 1189998427 X:46661597-46661619 CCACTAACTAGCTATCGCCACAT 0: 1
1: 0
2: 0
3: 4
4: 52
Right 1189998437 X:46661642-46661664 CAGTTGGCAGCAGCTAGCTGGGG 0: 1
1: 0
2: 0
3: 15
4: 205
1189998430_1189998437 5 Left 1189998430 X:46661614-46661636 CCACATAACACCATGTGGCCGGG 0: 1
1: 0
2: 0
3: 6
4: 66
Right 1189998437 X:46661642-46661664 CAGTTGGCAGCAGCTAGCTGGGG 0: 1
1: 0
2: 0
3: 15
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189998437 Original CRISPR CAGTTGGCAGCAGCTAGCTG GGG Intronic
900807235 1:4775556-4775578 CAGCTGGCTGCACCTTGCTGGGG + Intronic
900853625 1:5163221-5163243 CAGCTGACAGCAGCGAGATGAGG - Intergenic
901642263 1:10698749-10698771 CAGTTTGGAGGAGCTCGCTGGGG - Intronic
902387089 1:16082258-16082280 CAGCTGCCAGCAGCACGCTGGGG + Intergenic
902621500 1:17653539-17653561 CTGGTGGCAGCATCTAGTTGAGG - Intronic
903145882 1:21371781-21371803 GGGTTGGCAGCAGGGAGCTGGGG + Intergenic
903367314 1:22812987-22813009 TAGATGTCAGCAGCCAGCTGGGG - Intronic
904276900 1:29390785-29390807 CAGGGGGCAGCAGCCAGATGTGG + Intergenic
904861038 1:33537741-33537763 CAGGTGGAAGCACCTACCTGGGG - Intronic
905222296 1:36456757-36456779 CACAGGGCAGCAGCCAGCTGTGG - Intronic
905891075 1:41518694-41518716 CAGTGCACAGCAGCTAGGTGGGG + Intronic
907021440 1:51070150-51070172 CAGATGGTAGCAGGGAGCTGAGG + Intergenic
908011770 1:59785796-59785818 GATTTGGCAGCAGCCAGGTGTGG - Intergenic
908824096 1:68116839-68116861 CAGAGGGCAGCAAATAGCTGTGG + Intronic
909820010 1:80050556-80050578 CAGTTGTCAGGTGCTAACTGAGG - Intergenic
910222580 1:84903018-84903040 CAGGTTGCCGCTGCTAGCTGGGG - Intergenic
912551804 1:110489745-110489767 CAGACGGCAGCCGCTACCTGAGG - Intergenic
913256494 1:116958929-116958951 CTGTAGGCAGCAGCCAGCAGTGG - Intronic
914938526 1:152001756-152001778 ATGTTAGCAGCAGCTAGCTCTGG + Intergenic
915900133 1:159840811-159840833 CAGCTGGCTGGAGCTGGCTGAGG - Exonic
917336089 1:173925671-173925693 CATTTAGCAGCATTTAGCTGAGG + Intergenic
917854212 1:179088215-179088237 CAGAAAGCAGCAGCCAGCTGTGG + Intronic
918696321 1:187550741-187550763 CAGGTTGCAGCAGCTGGCTCAGG + Intergenic
923549915 1:234955377-234955399 CAGTTGGGAGCAGCTGGAGGAGG + Intergenic
1062895963 10:1103589-1103611 CCTTTGGCAGCAGATATCTGGGG + Exonic
1064367014 10:14717374-14717396 CAGTAGGCATCAGCAAGCTGGGG + Intronic
1068766155 10:60765975-60765997 AAGATGGCAGCAGTTACCTGAGG + Intergenic
1068839261 10:61591870-61591892 CAGTTGGGAGCAGATTGCTCTGG - Intergenic
1069760330 10:70806252-70806274 CAGTTGGCAGCAGCTATTGGAGG + Intergenic
1070270664 10:74951514-74951536 CAGTTGCCAGCACCTAGTTGTGG - Intronic
1070368092 10:75755778-75755800 CAGTGGGGAGCAGGCAGCTGTGG + Intronic
1070682238 10:78456727-78456749 GAGTGGGGAGCAGCCAGCTGTGG + Intergenic
1073921678 10:108466405-108466427 CAGCTGGCGGCCGCTCGCTGGGG + Intergenic
1075256021 10:120926613-120926635 CAGTGGAGAGCAGCCAGCTGGGG + Intergenic
1075268306 10:121025522-121025544 AGCTTGGCAGCAGGTAGCTGTGG - Intergenic
1077517002 11:3008099-3008121 CAGTTGGGCGCAGCAAGCTGAGG - Intronic
1079741253 11:24064254-24064276 CAATTGAAAGCAGCTAGCAGCGG + Intergenic
1080685443 11:34511527-34511549 AAGTTGGCTGCAGGTACCTGTGG + Exonic
1082912782 11:58395598-58395620 CTGGTGGCAGCAGCCAGCAGTGG + Intergenic
1083005003 11:59335764-59335786 CTGGTGGCAGCAGCTAGCAGAGG - Intergenic
1083315831 11:61814642-61814664 CGGGTTGCAGCAGCTGGCTGGGG + Intronic
1083636216 11:64122399-64122421 AAGATGGCAGCAGCTAGGAGGGG + Intronic
1083848557 11:65351893-65351915 CCTTTGGCAGCTGCAAGCTGAGG + Exonic
1084151978 11:67291890-67291912 CACTTGGCAGCAGGTGGCTGAGG + Intronic
1085819543 11:79777501-79777523 TAGTTGGTAGCAATTAGCTGGGG + Intergenic
1086123535 11:83326451-83326473 CAGGTGGCAGCAGCCAGCCATGG + Intergenic
1087874750 11:103342397-103342419 CAGCTTGCTGCAGCTGGCTGGGG - Intronic
1089554448 11:119308420-119308442 CAGTTGGCAGCAGAGATCAGGGG - Intergenic
1089691203 11:120187731-120187753 CACTTTCCAGCTGCTAGCTGGGG - Intergenic
1089868764 11:121654421-121654443 CTGTGGGCAGCAGAGAGCTGAGG + Intergenic
1090649235 11:128791851-128791873 CAGTTGGCAGCAGGATCCTGCGG - Intronic
1090912021 11:131129454-131129476 CTGGTGGCAGCAGCCAGCTGTGG + Intergenic
1090952213 11:131483734-131483756 CAGAGGCCAGCAGCCAGCTGAGG - Intronic
1091830232 12:3544147-3544169 CAGTTCCCAGCCTCTAGCTGTGG - Intronic
1093158739 12:15719652-15719674 CAGGTGGCAGAATTTAGCTGGGG + Intronic
1097277498 12:57823395-57823417 AAGTTGGCGGCAGGTAGCTCTGG + Exonic
1097326931 12:58287902-58287924 GAGTGGGCAGCAGCATGCTGAGG + Intergenic
1098953910 12:76669126-76669148 AAGTGGGGAGCAGCTAGGTGAGG - Intergenic
1099602563 12:84760283-84760305 CAGTTATAAGCTGCTAGCTGCGG - Intergenic
1101597363 12:106178826-106178848 CTGTTGACCGCAGCTACCTGAGG - Intergenic
1104298769 12:127543279-127543301 CAGATGACAGGAGCTAGGTGGGG - Intergenic
1104941891 12:132399164-132399186 AAGTTGGCGGCAGCTAAGTGTGG - Intergenic
1112641830 13:101283974-101283996 AGGTTGGCAGCTGGTAGCTGTGG - Exonic
1116117282 14:40671053-40671075 CAGTTGGTAGCAGGTAGCTTTGG - Intergenic
1117745038 14:58860725-58860747 ATGGTGGCAGCAGCCAGCTGTGG + Intergenic
1117759907 14:59015685-59015707 CTGGTGGCAGCAGCCAGCAGTGG + Intergenic
1121941640 14:98076340-98076362 CAGATGGAAGCAGAAAGCTGGGG - Intergenic
1123005829 14:105323329-105323351 CAGTGGGCGGCGGCTGGCTGGGG + Intronic
1125530241 15:40408458-40408480 CATTTGGGAGCAGATAGCGGGGG + Intronic
1125957303 15:43799355-43799377 CAGGAGGCAGCAGATTGCTGAGG + Exonic
1128562914 15:68680196-68680218 CAGCTGGCAGCATGTGGCTGGGG + Intronic
1129305384 15:74657251-74657273 CATATGGCAGCATCTAGGTGGGG - Intronic
1132372329 15:101307554-101307576 CAGTTGGCAGGAGCAAGCCCAGG + Intronic
1133312829 16:4861414-4861436 ATGTTGGCAGCAGGCAGCTGAGG + Intronic
1134028947 16:10976711-10976733 CAGTTAGCAACAGCATGCTGGGG - Intronic
1135075664 16:19391279-19391301 CAGGTTGCAGCTGCTGGCTGGGG + Intergenic
1136290150 16:29266877-29266899 CAACTGTCAGCTGCTAGCTGTGG - Intergenic
1140335510 16:74101122-74101144 CATTTGTCATCAGCAAGCTGGGG + Intergenic
1141419064 16:83899795-83899817 CAGTTGGCAGGCGGTAACTGCGG - Intronic
1141495368 16:84406149-84406171 CCGATGGCAGCAGCTAGCAAGGG - Intronic
1142096033 16:88240399-88240421 CAACTGTCAGCTGCTAGCTGTGG - Intergenic
1142331731 16:89458805-89458827 CAGTCAGCAGCAGGAAGCTGAGG - Intronic
1142606689 17:1085613-1085635 CAGTCGCCACCAGCTACCTGAGG + Intronic
1143253256 17:5537910-5537932 CAGTGGGGAGCAGCAGGCTGGGG + Intronic
1143741720 17:8959238-8959260 CTGTTGTCAGAAGCAAGCTGGGG - Intronic
1143894961 17:10128476-10128498 CATTTGGCCTCAGCTAGCTTTGG - Intronic
1145018885 17:19415177-19415199 CACGGGGCAGCAGCTAGCTCAGG + Exonic
1147020379 17:37526927-37526949 CAGTTGACAGAAGGCAGCTGTGG - Intronic
1147994051 17:44351737-44351759 GAGTTGGCAGCAGGTATCGGAGG - Exonic
1149993818 17:61396861-61396883 CAGTGGGCAGCAGGAAGCTCGGG - Intergenic
1151768583 17:76145163-76145185 CAGTAGGCAGCAGCTGAGTGAGG + Exonic
1151896868 17:76986585-76986607 CAGCTGGCAGCAGACAGCGGAGG - Intergenic
1153381186 18:4441220-4441242 CAATGGGCAGCAGGGAGCTGAGG + Intronic
1153583525 18:6598887-6598909 CATTCGGCAGCATCCAGCTGAGG - Intergenic
1153922307 18:9802804-9802826 CTGGAGGCAGCAGATAGCTGAGG + Intronic
1155785815 18:29898367-29898389 CAGGTGGCCGCTGCTAGCTCAGG + Intergenic
1160678279 19:401823-401845 CAGTAGGCAGCGTCTTGCTGAGG + Intergenic
1161262869 19:3347129-3347151 GAGGTGGCAGCTGCCAGCTGCGG - Intergenic
1161482255 19:4517009-4517031 CAATAGGCAGCAGGCAGCTGCGG - Intronic
1162152412 19:8655685-8655707 CAGGGGGCAGCAGCTGGGTGTGG - Intergenic
1162377099 19:10311108-10311130 CACTGGGGAACAGCTAGCTGAGG - Intronic
1163582213 19:18145638-18145660 CAAGAGGCAGCAGCTTGCTGGGG + Intronic
1164691764 19:30216058-30216080 AAGTTGGCAGCATCTAGGAGGGG + Intergenic
1166123601 19:40700435-40700457 CATTTGCCAGCAGCTGCCTGGGG + Exonic
1166346703 19:42170862-42170884 CATTTGGCTGAAGCTGGCTGGGG - Intronic
1168286456 19:55337102-55337124 CAGTTGGCATCACCTTGCTCTGG + Intergenic
925159361 2:1673280-1673302 CACATGGCAACAGCTGGCTGTGG + Intronic
931602180 2:64016079-64016101 TAGTTGGCAGCAACCAGATGAGG - Intronic
931669557 2:64634962-64634984 CAGTTGGCGGGAGATGGCTGTGG - Exonic
932125201 2:69139028-69139050 CAGTAGGTAGGAGCTAACTGGGG - Intronic
933447699 2:82403131-82403153 CAGGTTGCAGCTGCTGGCTGGGG - Intergenic
934155969 2:89200817-89200839 CAGATGGCACCATCTAGTTGCGG + Intergenic
934211353 2:89981944-89981966 CAGATGGCACCATCTAGTTGCGG - Intergenic
935016968 2:99192064-99192086 GAGTTGGCAGCAGTTATCTCGGG - Intronic
936679286 2:114752151-114752173 CAGTTGGGAGCAGCAGGCTAAGG - Intronic
938196079 2:129329657-129329679 CAGGTTGCAGCTGCTGGCTGGGG - Intergenic
939402170 2:141708843-141708865 CAGATGGCTGCTGCTTGCTGTGG - Intronic
940201520 2:151156628-151156650 GAGTGGGCAGCAGGAAGCTGTGG - Intergenic
942317459 2:174708968-174708990 CAGTTTGCCACTGCTAGCTGGGG + Intergenic
942590367 2:177538469-177538491 CAGCTGGCAGCAGCTTCCTCTGG - Exonic
943446582 2:187994565-187994587 CCACTAGCAGCAGCTAGCTGGGG - Intergenic
946153483 2:217791661-217791683 CATTTCCCAGCAGCTAGTTGAGG + Intergenic
946857715 2:223969444-223969466 GAGATGGCAGAATCTAGCTGTGG + Intergenic
948892776 2:240915390-240915412 CAGTTGGGGGCAGGCAGCTGAGG + Intergenic
1170064803 20:12299483-12299505 TTGTTGGCAGCAGCCAGCAGTGG + Intergenic
1170576315 20:17664382-17664404 CAGTTACCAGCAGAAAGCTGTGG - Intronic
1170627105 20:18038238-18038260 CAGTTGGCAGAGGCTTCCTGAGG - Intronic
1172186881 20:33036505-33036527 CAGTTGGATGTAGCTGGCTGTGG - Exonic
1173012597 20:39195774-39195796 CAGTTTGGAGCAATTAGCTGTGG - Intergenic
1173922590 20:46757432-46757454 CTGCAGGCAGCAGCTAGCTGGGG + Intergenic
1174168274 20:48600005-48600027 CAGTTGGAAGCAGATGTCTGGGG - Intergenic
1174569854 20:51493784-51493806 CAGTGGGGAGCAGCTCTCTGGGG - Intronic
1175116043 20:56683136-56683158 CTGTAGGCAGCAGGGAGCTGTGG + Intergenic
1175168484 20:57063074-57063096 CAGGTGGCAGCAGGTAGCAGAGG + Intergenic
1179831846 21:44001796-44001818 CAGATGGCAGAAGCCGGCTGTGG - Intergenic
1181035602 22:20168469-20168491 CAGGTGCCAGGAGCAAGCTGGGG - Intergenic
1183370358 22:37428316-37428338 CAGGTGGCAGCAGGTGGCAGGGG - Intergenic
1184517075 22:44969241-44969263 CAGCTTGCAGCAGCTGGCTTTGG - Intronic
950656844 3:14441798-14441820 CAGTTGTCACCAGCTGCCTGTGG + Intronic
951843596 3:27061612-27061634 AAGGTGGCAGCAGCCACCTGAGG - Intergenic
953138351 3:40203410-40203432 CACATGGCAGCACCCAGCTGTGG + Intronic
953201948 3:40785829-40785851 CGCTTGGCAGCAGCTTGGTGGGG - Intergenic
953685531 3:45075562-45075584 CAGTAGCCAGCAGCTACATGTGG - Intergenic
954455803 3:50599266-50599288 CAGTTCTCAGAAGCTACCTGGGG - Intergenic
957936933 3:86956415-86956437 GAGTTGTCATCAACTAGCTGCGG - Intronic
959028405 3:101269239-101269261 AACTTGTCAGCAGCAAGCTGGGG + Intronic
959643570 3:108670303-108670325 CAGTTGCCAGAAGCTAGAGGAGG - Intronic
959651539 3:108755784-108755806 CAGGTGGCAGCAGCGGGCAGTGG + Exonic
961007344 3:123413828-123413850 CAAATGGCAGCAGAGAGCTGGGG + Intronic
961305371 3:125955873-125955895 CAGTTGGCAGTAGTTGGCTCTGG + Intergenic
961387118 3:126528969-126528991 CTGCTGGCAGGAGCTTGCTGGGG + Intronic
961435265 3:126912442-126912464 ATTTTGGCAGCAGCTGGCTGTGG + Intronic
961636147 3:128334367-128334389 CAGCAGGCAGCAGGCAGCTGTGG - Intronic
964138228 3:153369320-153369342 CAGGTTCCAGCTGCTAGCTGGGG + Intergenic
965419178 3:168436059-168436081 CAGGTGGCCACAGCTTGCTGAGG + Intergenic
966705172 3:182905862-182905884 CAGTAGGCACCTGCTAGCTGAGG + Intronic
973943415 4:55933078-55933100 CAGGTGGCACCAGGTAGCTCTGG - Intergenic
975304129 4:72828765-72828787 CATTTGGCTGGAGGTAGCTGTGG - Intergenic
975405082 4:73980146-73980168 CAGAAGGCAGAATCTAGCTGTGG - Intergenic
984155854 4:176195465-176195487 CGGATGGGAGCTGCTAGCTGTGG + Exonic
984604241 4:181766339-181766361 CCGTTGCCACCAGCTAGCAGTGG + Intergenic
985929996 5:3049667-3049689 CAGTTGGCACCAGCATACTGAGG - Intergenic
989069514 5:37496232-37496254 CAGGTGGCGGCAGCTGGCTGGGG - Intronic
992950987 5:81857703-81857725 CAGTTGTCAGCGGCAACCTGGGG + Intergenic
994756231 5:103797064-103797086 CAGGTTGCCGCTGCTAGCTGGGG + Intergenic
995628662 5:114109195-114109217 CAGTTGCCAGCAAGTAGCTGAGG - Intergenic
998611534 5:143694441-143694463 TACTTGGCAGAATCTAGCTGTGG + Intergenic
999826345 5:155277103-155277125 GAGTTGGCAGAAGCTAGAAGTGG - Intergenic
999966973 5:156820351-156820373 CAGATGGCAGCAGGTGGCTTGGG - Intergenic
1000693223 5:164348259-164348281 CAGTTGGATGTAGCTACCTGTGG - Intergenic
1001105467 5:168850038-168850060 CATTTGTCTGCTGCTAGCTGGGG + Intronic
1001568374 5:172714831-172714853 CAGTTGGTGGGAGCCAGCTGAGG + Intergenic
1007030833 6:38624280-38624302 CAGGTTGCAGCTGCTGGCTGGGG - Intronic
1010986787 6:82434142-82434164 CAGTTGCCTGCAGGTACCTGTGG - Intergenic
1011808410 6:91099553-91099575 CACTTGGCACCAGCCATCTGTGG - Intergenic
1015657269 6:135532989-135533011 CAGTGGGCAGCACCTAGCAGTGG - Intergenic
1016349737 6:143154416-143154438 CAGTTGCCAGGAGCTAGTTAAGG + Intronic
1017041782 6:150314094-150314116 CATTTGTCAGCAGTTTGCTGAGG - Intergenic
1018349067 6:162937334-162937356 CAGCAGCCAGCAGCTACCTGTGG - Intronic
1018692588 6:166360664-166360686 CAGTTCTCAGCAGCTGCCTGAGG + Intergenic
1019905144 7:4056949-4056971 CTGGTGGCAGCAGCCAGCAGTGG - Intronic
1019962193 7:4470057-4470079 CTGTCAGCAGCAGCTGGCTGGGG + Intergenic
1021621693 7:22555731-22555753 CAGTTTGCAGCAGCAGCCTGTGG + Intronic
1022288406 7:28977270-28977292 CAGTTGGGAGAATCTGGCTGAGG - Intergenic
1024842598 7:53603897-53603919 CAGTTGGCAGTAGTTCTCTGTGG - Intergenic
1027179574 7:75928857-75928879 TACTTGCCGGCAGCTAGCTGTGG - Intronic
1031529791 7:122862539-122862561 CAGTGGGCAGAAGGGAGCTGTGG - Intronic
1032085946 7:128884032-128884054 CAGGGGGCAGGAGCTGGCTGGGG + Exonic
1032447594 7:131998040-131998062 TGGTAGGCAGCAGCGAGCTGTGG - Intergenic
1033209180 7:139447819-139447841 CAGGTGGCAGCAGGCAGCTTCGG - Intergenic
1033453475 7:141481973-141481995 CAGTTGCCAGCAGCTCTTTGAGG + Intergenic
1034152230 7:148926068-148926090 CAGCTTACAGCAGCCAGCTGAGG + Intergenic
1035869435 8:3121213-3121235 CAGTTGACAACAGCTTCCTGTGG + Intronic
1035987383 8:4449763-4449785 CAGTTGGGAGCAGCTATGTTTGG + Intronic
1036682814 8:10887911-10887933 AAGTTGGCAGCACCAAACTGAGG + Intergenic
1039563352 8:38530612-38530634 CAGTGGGCAGAAGAAAGCTGGGG - Intergenic
1041645888 8:60252232-60252254 CAATTGACAACAGCAAGCTGTGG + Intronic
1042227042 8:66522243-66522265 CACTGGGGAGCAGGTAGCTGGGG - Intergenic
1044072334 8:87778110-87778132 CTGGCAGCAGCAGCTAGCTGTGG - Intergenic
1044131702 8:88531661-88531683 CAGATGGCACCATCTTGCTGTGG - Intergenic
1044701349 8:94968043-94968065 CAGTAGCCAGCAGCGACCTGGGG - Intronic
1044826138 8:96199201-96199223 CAGTAGGAAGCAGGAAGCTGGGG - Intergenic
1045406866 8:101875320-101875342 CAGGAGGCAACAGCTAGCTCAGG + Intronic
1047253102 8:123195334-123195356 CAGTTGGCTTCACCTAGCTTTGG - Intronic
1049004247 8:139844852-139844874 CAGGTTGCCGCAGCCAGCTGGGG - Intronic
1049267269 8:141675035-141675057 AAATTGGAAGGAGCTAGCTGTGG - Intergenic
1050456802 9:5842149-5842171 CAGGTTGCAGCTGCTGGCTGGGG + Intergenic
1055266650 9:74500594-74500616 CAGTTGTCAGCTGCAAACTGTGG - Intronic
1055833467 9:80410502-80410524 TAAATGGCAGCAGCAAGCTGAGG + Intergenic
1057168638 9:92947580-92947602 CAGTGGGCAGCAGGAGGCTGGGG - Exonic
1059328384 9:113518674-113518696 CAGTAGGCAACAGCGAGCGGTGG - Intronic
1059731870 9:117064853-117064875 CAGTTGAAAGCATCTAGGTGGGG - Intronic
1060157382 9:121329132-121329154 CAGCTGGCTGCAGCTGGCAGGGG - Intronic
1061919053 9:133772212-133772234 CAGGTGGCAGGAGCTGTCTGGGG - Intronic
1062336923 9:136075348-136075370 CAGTTCGCAGCAGCCAGCCTCGG - Intronic
1203778949 EBV:90037-90059 GATTTGGCAGCAGCCACCTGCGG + Intergenic
1189544985 X:42033507-42033529 AATTTAGCAGCAGCTAGCTGGGG + Intergenic
1189561162 X:42192685-42192707 AAGTTGGCAGCAGATGGGTGAGG + Intergenic
1189998437 X:46661642-46661664 CAGTTGGCAGCAGCTAGCTGGGG + Intronic
1195235508 X:102893494-102893516 CAGTAGCCACTAGCTAGCTGTGG + Intergenic
1197309313 X:124884219-124884241 CTGGTAGCAGCAGCCAGCTGCGG + Intronic