ID: 1190003035

View in Genome Browser
Species Human (GRCh38)
Location X:46707908-46707930
Sequence CCTTCTCTACTAAAAATACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 735
Summary {0: 1, 1: 57, 2: 79, 3: 164, 4: 434}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190003035_1190003041 2 Left 1190003035 X:46707908-46707930 CCTTGTATTTTTAGTAGAGAAGG 0: 1
1: 57
2: 79
3: 164
4: 434
Right 1190003041 X:46707933-46707955 TTTCACCATGTTGGCCAGGCTGG 0: 87987
1: 159650
2: 173325
3: 160643
4: 141633
1190003035_1190003040 -2 Left 1190003035 X:46707908-46707930 CCTTGTATTTTTAGTAGAGAAGG 0: 1
1: 57
2: 79
3: 164
4: 434
Right 1190003040 X:46707929-46707951 GGGGTTTCACCATGTTGGCCAGG 0: 64910
1: 151465
2: 197443
3: 160987
4: 104258
1190003035_1190003039 -7 Left 1190003035 X:46707908-46707930 CCTTGTATTTTTAGTAGAGAAGG 0: 1
1: 57
2: 79
3: 164
4: 434
Right 1190003039 X:46707924-46707946 GAGAAGGGGTTTCACCATGTTGG 0: 1243
1: 77041
2: 145805
3: 129654
4: 76404

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190003035 Original CRISPR CCTTCTCTACTAAAAATACA AGG (reversed) Intronic
900852521 1:5155192-5155214 CCTTCTTTATTGGAAATACATGG + Intergenic
901383786 1:8893165-8893187 CCGTCTCTACTAAAAATACACGG + Intergenic
901403248 1:9028878-9028900 CCATCTCTATTGAAAATACATGG - Intergenic
902593543 1:17492238-17492260 CCGTCTCTGCTAAAAATATAAGG + Intergenic
903099726 1:21018397-21018419 CAGTCTCTACTAAAAATACAGGG + Intronic
904119459 1:28187651-28187673 CCACCTTTACAAAAAATACACGG - Intronic
904763179 1:32819773-32819795 AGTTCTATACTAAAAAAACATGG - Intronic
904766185 1:32849305-32849327 CCGTCTCTACAAAAAGTACCCGG - Intronic
904860024 1:33529889-33529911 CTTTCTCTATCTAAAATACAAGG - Intronic
905122066 1:35690012-35690034 CCGTCTCTACAAAAAATACCTGG - Intergenic
906029654 1:42708372-42708394 CCGTCTCTACAAAAATTAAAAGG - Intergenic
907037197 1:51226939-51226961 CCATCTCTACTAAAAATACAAGG + Intergenic
907441710 1:54482729-54482751 CTGTCTCTACTAAAAGTACAAGG - Intergenic
907824320 1:58000739-58000761 CCGACCCTACTAAAAATACAAGG - Intronic
907886431 1:58596441-58596463 CCGTCTCTACTAAAAATTAGCGG - Intergenic
907897472 1:58705248-58705270 CCTTTTCTCCTAAAAGTACAAGG + Intergenic
908415388 1:63908604-63908626 CCATCTTTACTAACAAAACATGG + Intronic
908849723 1:68363677-68363699 ATTTCTCTAATAAAAATCCATGG - Intergenic
909011378 1:70339048-70339070 CCGTCTCTACTAAAAATAGCCGG + Intronic
911292724 1:96077560-96077582 CCATCTCTACTAAAAATACAAGG - Intergenic
911454217 1:98103099-98103121 TCATCTCTACTATAAATACATGG - Intergenic
914729939 1:150361352-150361374 CCATCTCTACTAAAAATACAGGG - Intergenic
914796599 1:150925282-150925304 CCATCTCGACTAAAAATACAAGG - Intergenic
915174340 1:154002460-154002482 CCATCTCTACTAAAAATACGAGG + Intronic
915180702 1:154056958-154056980 CTTTCTCACCTGAAAATACATGG - Intronic
915961558 1:160271243-160271265 CCATCTCTACAAAAAATTTAAGG - Intergenic
916709102 1:167386354-167386376 CCATCTCTACAAAAAATAGCTGG - Intronic
917014968 1:170519849-170519871 CCATCTCTACTAAAATTAGCCGG - Intergenic
917047775 1:170881990-170882012 CCTCTTCTACGAAAAATAGATGG + Intergenic
917296198 1:173522024-173522046 CCGTCTCTACTAACAATACACGG + Intronic
917711259 1:177687707-177687729 CCTTCACTCCAAAAAACACATGG + Intergenic
918044663 1:180934704-180934726 CAATCACTACCAAAAATACATGG + Intronic
919552068 1:199003079-199003101 CTTTCTCTAAGAAAAATAAAAGG - Intergenic
919910972 1:202110576-202110598 CCGTCTCTGCTAAAACTACAAGG - Intergenic
919941597 1:202290700-202290722 CCATCTCTACTAAAAATACAAGG + Intronic
919978208 1:202626535-202626557 CCTTCTCTACAAAAAAGAGCCGG - Intronic
920351440 1:205340643-205340665 CCGTCTCTACTAAAAATACCAGG - Intronic
920368354 1:205460538-205460560 CCGTCTCTACTCAAAATAAAAGG + Intergenic
920442603 1:205990941-205990963 CCGCCTCTACTAAAAATACGTGG - Intronic
921018440 1:211213707-211213729 CCCTGTCTCCAAAAAATACAAGG + Intergenic
921227332 1:213033152-213033174 CATTCTCTGCTCAAAACACATGG - Intergenic
921392243 1:214628259-214628281 CCTTTTCTACTAAACACAGAAGG - Intronic
921886117 1:220308142-220308164 CCATCTCTACTAAAAATACAAGG - Intergenic
922103122 1:222490411-222490433 CCATCTCTACTAAAATTAGCTGG + Intergenic
922266175 1:223986101-223986123 CCGTCTCTACTAAAAATACAAGG + Intergenic
923980843 1:239321388-239321410 CCTTCTCTATTAAAATAAAATGG + Intergenic
924117032 1:240757971-240757993 CCGTCTCTACTAAAGGTACAAGG - Intergenic
924761938 1:246995657-246995679 CCGTCTCTACTAAAAAGACACGG + Intronic
1062769850 10:90948-90970 CCATCTGTACCAAAAATACAAGG + Intergenic
1062833242 10:619863-619885 CCTGGTCTACTTAAAGTACAGGG - Intronic
1063132389 10:3189335-3189357 CCATCTCTACAAAAAATATCTGG - Intergenic
1063588212 10:7372086-7372108 CCATCTCTACTAAAATTAGCTGG - Intronic
1063952379 10:11235780-11235802 ACTTCTCTCCTAAAAATAAATGG - Intronic
1064093106 10:12402110-12402132 CTGTCTCTATTAAAAACACAAGG - Intronic
1064429421 10:15257997-15258019 CCTGCTCTCCTGAAAATACGGGG + Intronic
1064480225 10:15733374-15733396 CCATCTCTACACAAAATAGAAGG + Intergenic
1064740608 10:18430180-18430202 CCTATTCTACTTAAAAAACACGG - Intronic
1064801094 10:19073083-19073105 CCATCTCTAATAAAAATATAAGG - Intronic
1065364136 10:24918359-24918381 CATTCTCCACTAAAATGACATGG - Intronic
1065442598 10:25768555-25768577 CCATCTCTACAAAAAATTAATGG + Intergenic
1065711584 10:28523149-28523171 CCATCTCTACTAAAGATGCAAGG - Intergenic
1065791877 10:29268104-29268126 CCGTCTCTAGAAAAAATAAATGG - Intergenic
1066339174 10:34512792-34512814 TCTTCTATACTAAGAATACTGGG + Intronic
1067113717 10:43418970-43418992 CCATCTTTACTAACAATACAAGG - Intergenic
1067895247 10:50172348-50172370 CCTTCAAGACTACAAATACATGG + Intergenic
1067953736 10:50769630-50769652 CCTTCAAGACTACAAATACATGG - Intronic
1069009324 10:63353675-63353697 CCATCTCTACTAAAAATAACTGG - Intronic
1069501653 10:68958273-68958295 CTGTCTCTACAAAAAATAAAAGG - Intronic
1069502598 10:68967337-68967359 CCATCTCTACTAAAAATACGAGG - Intronic
1069867542 10:71513024-71513046 CCTTATCTAATAAAAACAAAGGG + Intronic
1070072621 10:73104436-73104458 CTATCTCTACTAAAATTACAAGG - Intergenic
1070121220 10:73579119-73579141 CCATCTGTACTAAAAATACATGG - Intronic
1070270650 10:74951457-74951479 CCATCTCTACAAAGAATACAAGG - Intronic
1070722456 10:78765969-78765991 CCTCCTCTTCTGAAAATCCAGGG - Intergenic
1071330342 10:84552604-84552626 CCTTCTTTCCTACAAATACCTGG - Intergenic
1072316652 10:94210312-94210334 CTTTCTCTACAAAAAAAGCAAGG + Intronic
1072818043 10:98528831-98528853 CTTTTTCTCTTAAAAATACATGG - Intronic
1072979354 10:100086851-100086873 CCATCTCTACAAAAAATCAAAGG + Intergenic
1073374736 10:103023380-103023402 CCATCTCTACTAAAAATAGAGGG + Intronic
1073384156 10:103109017-103109039 CCGTCTCAACTAAAAATACCAGG - Intronic
1074490624 10:113936381-113936403 CGGTTTCTACTAAAAAAACATGG - Intergenic
1074756102 10:116625281-116625303 CCGTCTCTACTAAAATTAGCTGG - Intronic
1074977206 10:118591267-118591289 CCATCTCTACAAAAAATAGCCGG - Exonic
1075058072 10:119234843-119234865 CTGTCTCTACTAAAAATACAAGG - Intronic
1075618216 10:123906775-123906797 CTTTCTCTCCTAAAAGTGCATGG - Intronic
1075792862 10:125097957-125097979 CCATCTCTACTAAAAGTAGCTGG + Intronic
1075857224 10:125640013-125640035 CCTTCTCTGCTGAGAACACATGG - Intronic
1076359525 10:129877318-129877340 CCATCTCTACTAAAAATACTGGG + Intronic
1076742198 10:132491742-132491764 CCGTCTCTACTAAAAACACAAGG - Intergenic
1076759247 10:132592575-132592597 CCATCTCTACTAAAAATAGCTGG - Intronic
1076985696 11:234585-234607 CCGTCTTTACTAAAAATACAAGG - Intronic
1077964397 11:7112443-7112465 CCTAGTTTACTAAAAATACTGGG + Intergenic
1077964495 11:7114186-7114208 CTGTCTCTACTAAAAAGAAAAGG + Intergenic
1078618154 11:12883839-12883861 CCGTCTCTACTAAAAATACATGG + Intronic
1079012889 11:16844164-16844186 CCTGCTGTACAAAAAATTCATGG + Intronic
1079663274 11:23069450-23069472 CCTTCTCCACTAAGAAGACCAGG + Intergenic
1079941312 11:26684128-26684150 CTTTCTCTATAAAAAATATAAGG + Intronic
1081891806 11:46549043-46549065 TCTTCTCCACTAAAGATCCAGGG + Intronic
1081932576 11:46882309-46882331 CCATCTCTACCAAAAAAAAAGGG + Intronic
1083097214 11:60263940-60263962 TCTTCTGAACTAATAATACAAGG - Intergenic
1083247574 11:61441358-61441380 CCGTCTCTACTAAAAATACTGGG + Intronic
1083456070 11:62779493-62779515 CCGTCTCTATTAAAAATATAAGG - Intronic
1083600794 11:63946373-63946395 CCGTCTCTACAAAAATTACCCGG - Intronic
1083834937 11:65260494-65260516 CCTTCTCTACAAAAAATTAGCGG - Intergenic
1085586561 11:77713491-77713513 CATTTTCTAGTAAAATTACAGGG - Intronic
1086216874 11:84394045-84394067 CTGTCTCTACTAAAAATAGCTGG - Intronic
1086515965 11:87613658-87613680 CCTTCTCTACTAATAATGCAAGG - Intergenic
1086614331 11:88797310-88797332 CCGTCTCTACTAAAAATTAGCGG - Intronic
1086744487 11:90408049-90408071 CCTGCTCTACCAAAAATGTAAGG + Intergenic
1086799192 11:91150506-91150528 CCATCTCTACTAAAAATACAAGG - Intergenic
1087763031 11:102122245-102122267 CGATCTCTACTAAAAATAGAAGG + Intronic
1088094655 11:106084783-106084805 CCGTCTCTACTAAAAATACCAGG - Intronic
1089232116 11:116987664-116987686 TTTTCTCTCCTAAAAATAGATGG - Intronic
1089279648 11:117364666-117364688 CCATCTCTACAAAAAATAGCCGG - Intronic
1090243433 11:125199671-125199693 CCATCTCTACTAAAAATACAAGG + Intronic
1090432389 11:126656879-126656901 CCGTCTCTACTAGGAATACAGGG + Intronic
1090529881 11:127579296-127579318 CCATCTCTACTAAAAATACTGGG + Intergenic
1090670801 11:128943873-128943895 CATTCTCTACAATAAAAACATGG - Intergenic
1090846007 11:130530425-130530447 TCTTCTCTGCTAGAAATACTTGG + Intergenic
1091258321 11:134211475-134211497 CTGTCTTTACAAAAAATACAGGG + Intronic
1091429131 12:417741-417763 CCGTCTCTACTAAAATTAGCTGG + Intronic
1091951666 12:4597902-4597924 CCATCTCTACTAAAAATAGCCGG + Intronic
1092351512 12:7759814-7759836 CCATCTCTACTAAAAATACTAGG - Intergenic
1092885972 12:12924688-12924710 CCATCTCTACAAAAGATAAAAGG - Intergenic
1093472333 12:19515927-19515949 CTGTCTCTACAAAAAATACATGG + Intronic
1093523114 12:20073265-20073287 TCACCTCTACTAAAAATAGAAGG + Intergenic
1095432571 12:42149763-42149785 CCGTCTCTACTAAAAACAGTCGG + Intergenic
1095934781 12:47666052-47666074 CCTCCTGTACTAAACATACATGG - Intronic
1096373403 12:51087012-51087034 CCATCTCTACTAAAAATAGCTGG + Intergenic
1097038478 12:56139756-56139778 CCGTCTCTACTAAAAATTGGTGG - Intronic
1097044460 12:56177114-56177136 CCATCTCTACTAAAAAGACCAGG - Intronic
1097060454 12:56279464-56279486 CCGTCTCTATTAAAAACACAAGG + Intronic
1097124966 12:56766771-56766793 CCTTCTCTACCCTAAATGCAAGG - Intronic
1097781335 12:63708434-63708456 CTGTCTCTACTAAAAATACCTGG + Intergenic
1098203053 12:68077593-68077615 CCTTATCTCCTTAAAATACCTGG + Intergenic
1098213423 12:68190168-68190190 CCTCATCTACTGAAAAAACATGG - Intergenic
1099186033 12:79516258-79516280 CCGTCTCTACTAAAATTAGCCGG + Intergenic
1099351428 12:81574411-81574433 CTTTCTTTAAAAAAAATACAAGG - Intronic
1099478970 12:83142593-83142615 CCGTCTCTACGAAACATACCCGG + Intergenic
1100216869 12:92459648-92459670 CTTTATCTACTAAAAATTCCAGG + Intergenic
1100235507 12:92656807-92656829 GCTTCTGTAGTTAAAATACAGGG - Intergenic
1100583714 12:95959955-95959977 CCGTCTCTACTAAAAGTATCGGG - Intronic
1101907974 12:108841971-108841993 CTGTCTCTACCAAAAATACAAGG + Intronic
1102264875 12:111474911-111474933 CCATCTCTATTAAAAATACAAGG + Intronic
1102291793 12:111706946-111706968 CTGTCTCTACTAAAAATTCAGGG - Intronic
1102383255 12:112485088-112485110 CCTTCTCTACTAAAATTAGCTGG + Intronic
1102673808 12:114642726-114642748 CCATCTCTACTAAAAAAGCCAGG + Intergenic
1102798330 12:115709052-115709074 TCTTATCCACTAAAAATAAATGG + Intergenic
1103414252 12:120733269-120733291 CCGTCTCTACTAAAAATACAAGG - Intronic
1103720597 12:122973262-122973284 CCGTTTCTACTAAAAATACAAGG + Intronic
1103770026 12:123314765-123314787 CCATCTCTACAAAAATTAGATGG - Intronic
1104938277 12:132379008-132379030 CCGTCTCTACTAAAAATACATGG + Intergenic
1105249893 13:18688975-18688997 CTGTCTCTACTAAAAGTACTGGG + Intergenic
1105366636 13:19771307-19771329 CTGTCTCTACTAAAAATATGAGG - Intronic
1105567543 13:21565355-21565377 CTGTCTCTACTAAAAACACAAGG + Intronic
1107241835 13:38244789-38244811 CCATCTCTAATAAAAATAGCTGG + Intergenic
1107462572 13:40618236-40618258 CCTTCTCTACAAAAATTAGCAGG - Intronic
1107687543 13:42918867-42918889 CCTTCTCTAATATAAAAAGAAGG - Intronic
1107802955 13:44127365-44127387 CCTTCTCTACAAAAATTAGCTGG - Intergenic
1107931706 13:45312498-45312520 CTGTCTCTACTGAATATACACGG + Intergenic
1108191492 13:47944950-47944972 CTATCTCTACTAAAAATACAAGG + Intronic
1108805048 13:54144240-54144262 CCATCTCTACAAAAATTAGACGG + Intergenic
1109628629 13:65013548-65013570 CCATCTGTACTAAAAATACAAGG - Intergenic
1110333265 13:74296856-74296878 AGTTCCCTACTAAAAATACCTGG - Intergenic
1111147079 13:84196418-84196440 CTGTTTCCACTAAAAATACATGG + Intergenic
1111702412 13:91707450-91707472 CCATCTCTACAAAAAAAATAAGG + Intronic
1112021825 13:95378546-95378568 CCTTCTCTACACAAAATAAATGG + Intergenic
1112714406 13:102167128-102167150 CAATCTCTACTAAAAATACAAGG + Intronic
1112768552 13:102772735-102772757 CCGTCTCTACTAAAATTAGCTGG - Intronic
1113080646 13:106516326-106516348 CCCTCTCTACTTAAAATGCAAGG + Intronic
1113663248 13:112121524-112121546 CTGTCTCTACTGAAAATACAAGG - Intergenic
1114146522 14:19983652-19983674 CCCTCTCTACCCCAAATACAGGG - Intergenic
1114475043 14:22988293-22988315 CCATCTCTACTAAAAAGAGCTGG - Intronic
1114796111 14:25716922-25716944 CCCTCTCTACTAAAATTAGCTGG + Intergenic
1115091875 14:29586793-29586815 CCATCTCTACTAAAAATACCAGG - Intronic
1115414759 14:33119390-33119412 CCTCCTCCACTAAAAATAGTGGG - Intronic
1115458982 14:33637778-33637800 CGTTCTTTATAAAAAATACATGG - Intronic
1115562810 14:34598551-34598573 CCATCTCTATTAAAAATAGTTGG - Intronic
1115567126 14:34634444-34634466 CTGTCTCTACTAAAAATTAAGGG + Intergenic
1116004262 14:39275460-39275482 TCTTCTCTTCTAAAAGGACATGG - Intronic
1116442416 14:44968418-44968440 CCGTCTCTACTAAAAATACTGGG - Intronic
1117480554 14:56139877-56139899 GCTTCTTTACTAAAAAAAAAAGG + Intronic
1117710556 14:58524875-58524897 CCATCTCTACTAAAAATAGCTGG - Intronic
1118273615 14:64365954-64365976 CCGTCTCTACTAAAAATACCTGG - Intergenic
1118784082 14:69031143-69031165 TCATCTCTACAAAAAATACAAGG + Intergenic
1119276617 14:73362602-73362624 CCGTCTCTACAAAAAATAGCTGG - Intronic
1119803795 14:77468876-77468898 CCATCTCTACTAAAATTACGTGG - Intronic
1120743621 14:88134150-88134172 TTTTCTCTACTAAAAATTCCTGG - Intergenic
1120787383 14:88550082-88550104 CTGTCTCTACTAAAAATACAAGG - Intronic
1120983003 14:90307701-90307723 CCATCTCTACTAAAAATACAGGG + Intronic
1121062467 14:90926233-90926255 CTGTCTCTACTAAAAATGCATGG + Intronic
1121110482 14:91309431-91309453 CCCTCTATACAAAACATACAAGG + Intronic
1122053244 14:99074461-99074483 CCATCTCTACTAAAATTAGCCGG + Intergenic
1122700710 14:103586737-103586759 CCGTCTCTACTAAAAATACTGGG - Intronic
1122705904 14:103621303-103621325 CCATCTCTACTAAAATTAGTAGG + Intronic
1123153746 14:106205755-106205777 CCTTCTCTATTAGACAGACAAGG + Intergenic
1123436631 15:20259323-20259345 CCCTCTCTACCAAAAATACATGG + Intergenic
1123691752 15:22843866-22843888 CCATCTCTACAAAACATACCTGG - Intronic
1123991640 15:25687884-25687906 TCTTCTCTTCTCAAAATGCAAGG + Intronic
1124493836 15:30174468-30174490 CCTTCTCTACAAAAAAGAGCCGG - Intergenic
1124580479 15:30950129-30950151 CCTTTTCTATTACAAATGCATGG + Intronic
1124749732 15:32364178-32364200 CCTTCTCTACAAAAAAGAGCCGG + Intergenic
1125138972 15:36380670-36380692 CCTTCTCTTCATAGAATACAAGG - Intergenic
1126866412 15:52941992-52942014 CCTTTTCTTCTAAAAATTCCTGG + Intergenic
1127788043 15:62373312-62373334 CCATCTCTACTAAAATTAGCTGG + Intergenic
1128076984 15:64833312-64833334 CGGTCTCTGCTAAAAATACAAGG - Intergenic
1128204533 15:65839006-65839028 CCATCTCTACTAAAAATACAAGG - Intronic
1128536694 15:68496985-68497007 CCATCTCTATTAAAAATAGCTGG - Intergenic
1128999910 15:72323389-72323411 GCTTCTCTACTAAAAATACAAGG - Intronic
1129020265 15:72510570-72510592 CCATCTCTACTAAAAAAATTAGG + Intronic
1129021183 15:72520202-72520224 GCTTCTCTACAGAAACTACAAGG - Intronic
1130182448 15:81644263-81644285 CATTCTCTATTCCAAATACATGG - Intergenic
1130204770 15:81865734-81865756 CCATCTCTACTAAAAATAGCAGG + Intergenic
1130290213 15:82592415-82592437 CCATCTCTACCAAAAATACAGGG + Intronic
1130767931 15:86891695-86891717 CCTTCTCTACTCAAGTGACATGG + Intronic
1131171582 15:90182844-90182866 CCGTCTCTACTGAAAATACATGG - Intronic
1132127919 15:99245978-99246000 CCGTCTCTACTAAAATTAGCTGG - Intronic
1132155129 15:99490622-99490644 CTGTCTCTACTGAAAATACAAGG - Intergenic
1132267122 15:100484000-100484022 CCACCTCTACTAAAAATCCTGGG + Intronic
1132387252 15:101409283-101409305 CTGTCTCTATTAAAAATACAAGG + Intronic
1133208367 16:4247938-4247960 CCATCTCTACTAAAAATACCAGG + Intergenic
1133241792 16:4418492-4418514 CCGTCTCTACTAAAAATACAAGG + Intronic
1133500837 16:6365181-6365203 CCCTCTCTTCTTAAAATAGATGG + Intronic
1134091336 16:11393162-11393184 CCGTCTCTACTTAAAAAAAAGGG - Intronic
1134754948 16:16658774-16658796 CCATCTCTACTAAAGAGACTAGG + Intergenic
1134991115 16:18700375-18700397 CCATCTCTACTAAAGAGACTAGG - Intergenic
1135052821 16:19206307-19206329 CCTTCTCCACTAGAACTTCATGG + Intronic
1136400212 16:30012843-30012865 CCATCTCTGCTAAAAATGCCGGG + Intronic
1136427238 16:30177067-30177089 CCGTCTCTACTAAAAAAATATGG + Intergenic
1136693442 16:32054236-32054258 CCTTCTCTCGTATAAGTACAAGG + Intergenic
1136793934 16:32997459-32997481 CCTTCTCTTGTATAAGTACAAGG + Intergenic
1136847938 16:33591532-33591554 CCCTCTCTATCAAAAATACATGG - Intergenic
1136875977 16:33856920-33856942 CCTTCTCTCGTATAAGTACAAGG - Intergenic
1136989944 16:35145961-35145983 CCGTCTCTACTAAAATTAGCCGG - Intergenic
1137624759 16:49900609-49900631 CTTGCTCAACTAAAAAGACAAGG - Intergenic
1137672317 16:50286220-50286242 CCATCTCTACAAAAAATACATGG + Intronic
1138281544 16:55775590-55775612 CCTTCTTTTCTAAGAATCCAGGG - Intergenic
1138996459 16:62459082-62459104 CCATGTCTACTAAAAAAAAAAGG - Intergenic
1139234719 16:65325583-65325605 CCGTCTCTACTAAAAATACCAGG - Intergenic
1139443623 16:66982412-66982434 CTTTCTCTACAAAAAATAAAAGG - Intergenic
1139555924 16:67710288-67710310 CGGTTTCTACTAAAAATACAGGG - Intronic
1139619510 16:68126052-68126074 CCATCTCTACTAAAATTAGCTGG - Intronic
1139704083 16:68728464-68728486 CCATCTCTATTGAAAATACAAGG - Intergenic
1139742246 16:69045280-69045302 CCGTCTCTACTAAAATTAGCCGG + Intronic
1140021634 16:71244593-71244615 CCTTCTCTACCATGAATAAATGG + Intergenic
1140260151 16:73371149-73371171 CTGTCTCTACTAAAAATATGTGG + Intergenic
1140413134 16:74753506-74753528 CCGTCTCTACTAAAAATAGCTGG + Intronic
1140603228 16:76502891-76502913 CCTTCTTTCCTAGAAAAACATGG - Intronic
1140753231 16:78045330-78045352 CCATCTCTACTAAAAGTAGCGGG + Intronic
1141118890 16:81335444-81335466 CTGTGTCTACTAAAAATACATGG + Intronic
1141164830 16:81653366-81653388 CCTTCTCTACTCCACAGACACGG - Intronic
1203096195 16_KI270728v1_random:1259152-1259174 CCTTCTCTCGTATAAGTACAAGG + Intergenic
1203109646 16_KI270728v1_random:1440181-1440203 CCCTCTCTATCAAAAATACATGG - Intergenic
1142531945 17:585484-585506 GAATCTCTACTAAAAATAGAGGG + Intronic
1142724725 17:1804345-1804367 CTGTCTCTACTAAAAATACAGGG - Intronic
1142819286 17:2451973-2451995 CCATCTCTACAAAAAATAGCTGG + Intronic
1143169803 17:4922075-4922097 CTGTCTCTACTAAAAATTCAGGG + Intergenic
1143945318 17:10586579-10586601 CCGTTTCTACAAACAATACAAGG - Intergenic
1143950337 17:10627419-10627441 CCTTATCTTTTAAAAATACATGG - Intergenic
1143999517 17:11039928-11039950 CTTTCTCTTCTAGAAATAAATGG - Intergenic
1144292149 17:13837221-13837243 CCGTCTCTACTAAAAATACAAGG - Intergenic
1144382551 17:14717010-14717032 ACTGATTTACTAAAAATACAGGG + Intergenic
1144522436 17:15962686-15962708 CCGTCTCTACTAAAAATGCGTGG - Intronic
1144841133 17:18186601-18186623 ACTTCTGTTCTTAAAATACAGGG - Intronic
1144867432 17:18345545-18345567 CCGTCTCTACTAAAAATACATGG - Intronic
1145045588 17:19612608-19612630 TCATCTCTACTAAAAATAGCTGG + Intergenic
1145931992 17:28692460-28692482 CCATCTCTACTAAAAATATAAGG + Intronic
1146047879 17:29525564-29525586 CCTTCTCTACTAAAAACACGAGG - Intronic
1146050926 17:29552891-29552913 CCATCTCTACTAAAAATACATGG + Intergenic
1146070183 17:29673397-29673419 CCATCTCTACTAAAAATACAAGG + Intronic
1146228310 17:31087002-31087024 GCAACTCTACTAAAAATACACGG + Intergenic
1146390101 17:32414202-32414224 AATTCTCTACTAAAATTAGATGG + Intergenic
1146593631 17:34150940-34150962 CCATCTCTACTAAAAATACCAGG + Intronic
1147181975 17:38692260-38692282 CCATCTCTACTAAAAATACGAGG - Intergenic
1147192294 17:38745040-38745062 CCATCTCTACTAAAAATACATGG + Intronic
1147231650 17:39023742-39023764 CCATCTCTACTAAAAATAGCCGG - Intergenic
1147273054 17:39290731-39290753 CCATCTCTACAAAAAATAAAAGG - Intronic
1147292099 17:39451718-39451740 CCGTCTCTACTAAAAATAGCTGG - Intergenic
1147780554 17:42938172-42938194 CCGTCTCTATAAAAAATAAATGG + Intergenic
1147868893 17:43573293-43573315 CCTCCTCTACTAAGAGTTCAAGG - Intronic
1147932637 17:43992408-43992430 CCGTCTCTACTAAAAATACAAGG + Intronic
1148380809 17:47195527-47195549 CAGTCTCTACTAAAAATACTTGG - Intergenic
1148704821 17:49620305-49620327 CTGTCTCTACTAAAAATACCAGG + Intronic
1148774131 17:50085040-50085062 CCGGCTCTACTAAAAATGCTGGG + Intronic
1148823730 17:50376886-50376908 CAATCTCTACAAAAAACACAGGG - Intronic
1150269682 17:63855596-63855618 CCGTCTCTACTAAAATTAGCCGG + Intergenic
1150353352 17:64462794-64462816 CTGTCTTTACTAAAAATACATGG - Intronic
1150372362 17:64651039-64651061 CTGTCTCTACTAAAAATACATGG + Intronic
1150736228 17:67741731-67741753 CTGTCTCTACTAAAAGCACAGGG - Intronic
1151069548 17:71193124-71193146 CCTTCTTTACTTAAAAAACTTGG + Intergenic
1151538790 17:74753716-74753738 TCGTCTCTACCAAAAAAACAGGG + Intronic
1152402596 17:80076904-80076926 CTATTTCTACTAAAAATACCAGG - Intronic
1152881524 17:82818894-82818916 CCGTCTCTGCTAAAAATACAAGG + Intronic
1154368107 18:13729958-13729980 CCGTCTCTACAAAAAATAGCTGG - Intronic
1154438936 18:14369921-14369943 CTGTCTCTACTAAAAGTACTGGG - Intergenic
1156318229 18:35991642-35991664 CATGCACTACTAATAATACATGG - Exonic
1156860831 18:41834625-41834647 CTGTCTCTATTAAAGATACAAGG - Intergenic
1156861893 18:41846673-41846695 CCCTCTCTACCACAAAAACAAGG + Intergenic
1156990924 18:43406564-43406586 CCATCTTTACTAAAAATACTGGG - Intergenic
1157230907 18:45915106-45915128 CTGACTCTACTAAAAATACAAGG + Intronic
1157742689 18:50107285-50107307 CTGTCTCCACTAAAAATACCAGG - Intronic
1157903615 18:51545034-51545056 CCTTCTCTGCTAGAAATATAGGG + Intergenic
1158529551 18:58246872-58246894 TGTTCTCTATTAAAAATACTTGG + Intronic
1158556043 18:58475489-58475511 CCATCTCTACCAAAAAAAGAAGG + Intergenic
1158584994 18:58724972-58724994 CCATCTCTACTAAAAATGTATGG + Intronic
1158970101 18:62658467-62658489 CTGTCTCTACTAAAAATAATTGG - Intergenic
1159577093 18:70192508-70192530 CCATCTCTACAAAAAATAAAAGG + Intronic
1160760265 19:780602-780624 CCATCTCTATTAAAAATAAAAGG - Intergenic
1160912392 19:1480924-1480946 CCATCTCTACTAAAAAAGGAAGG + Intergenic
1161413123 19:4128189-4128211 CTGTCTCTACTAAAAATACAAGG + Intergenic
1161426521 19:4206621-4206643 CCGTCTCTACAAAAAGTATAGGG + Intronic
1161533575 19:4804718-4804740 CCATCTCTACAAAAAATGTAGGG + Intergenic
1161828351 19:6584857-6584879 TCACCTCTACTGAAAATACAGGG - Intronic
1162347794 19:10130609-10130631 CCATCTCTACTAAAATTAGCTGG + Intergenic
1162656926 19:12138280-12138302 CCATCTCTACTTAAAATACATGG + Intronic
1163108986 19:15146372-15146394 CCATCTCTACTAAAAATAGCCGG + Intergenic
1163626566 19:18393450-18393472 CCGTCTCTACTAAAATTAGCCGG + Intronic
1164380619 19:27734427-27734449 GCCTCTCTAATAAAAATACCTGG + Intergenic
1165193843 19:34085863-34085885 CTGTCTCTACAAAAAATACAAGG - Intergenic
1165667906 19:37649659-37649681 CCATCTCTACAAAAAATTAACGG + Intronic
1165886353 19:39081828-39081850 CCGTCTCTACTAAAAATACAAGG + Intergenic
1166657279 19:44621476-44621498 CCATCTCTACAAAAAATAGCTGG + Intronic
1166811866 19:45519312-45519334 CCTTCTCTACTAAAATACAAGGG - Intronic
1167051184 19:47079723-47079745 CCGTCTCTACTGAAAATAGCTGG + Intronic
1167136943 19:47622262-47622284 CCATCTCTACTAAAAAAGTATGG - Intronic
1167239478 19:48334751-48334773 CCGTCTCTACAAAAAATATCGGG - Intronic
1167399274 19:49254193-49254215 CCGTCTCTACTAAAATTAGTTGG + Intergenic
1167656058 19:50765041-50765063 CCTTCTCTCCTATGAAGACATGG - Intergenic
1167839758 19:52105916-52105938 CCGTCTCTACAAAAATTACCTGG - Intergenic
1167893084 19:52558244-52558266 CCGCCTCTACTAAAAATACAAGG - Intronic
1168463247 19:56579842-56579864 GCTTCTCAACTAAAAAAATATGG - Exonic
926509406 2:13755484-13755506 CCTTTTCTAATAACATTACATGG + Intergenic
926604492 2:14883797-14883819 CCATCTCTACAAAAAATACCTGG + Intergenic
926883126 2:17570872-17570894 CCAATTCTACTAAAAATACCAGG + Intronic
927127760 2:20028496-20028518 CTGTCTCTACTAAAAATACAAGG - Intergenic
927852274 2:26506827-26506849 CCGTCTCTACTAAAATTAGCTGG + Intronic
928695091 2:33841179-33841201 CCGTCTCTACTAAAATTAGCTGG + Intergenic
929514437 2:42593806-42593828 CCATCTCTATAAAAAATAAATGG + Intronic
929971801 2:46585523-46585545 CCTACTATACTTAAAATGCAGGG + Intronic
930351101 2:50255490-50255512 CTTTCTAGACTAAAATTACAAGG + Intronic
930731244 2:54729963-54729985 CCATCTCTACAGAAAATACAAGG + Intronic
930759084 2:55012593-55012615 TAATCTCTACTAAAAATAGAAGG + Intronic
932489385 2:72110542-72110564 CCATCTATAATAAAAATACTTGG - Intergenic
933022781 2:77216044-77216066 GCTTTTCTACAAAAAATAGAAGG - Intronic
933294231 2:80471481-80471503 CAGTCTCTACTAAAAATATCTGG + Intronic
933364289 2:81329059-81329081 CATTCTCTATGAAAAATGCATGG - Intergenic
934066469 2:88346369-88346391 CCTGCTCTACTAAGAGTTCAAGG - Intergenic
934073512 2:88407668-88407690 CTGTCTCTACTAAAAATAGTCGG + Intergenic
935742410 2:106161274-106161296 TCATCTCTACAAGAAATACAAGG - Intronic
936907396 2:117552926-117552948 CCTTCTCACCTAAAAAGAGATGG + Intergenic
937747704 2:125434540-125434562 CCATCTCTACAAAAAGTAAATGG + Intergenic
937881693 2:126871882-126871904 CCGTCTCTACTAAAAATAGACGG + Intergenic
937931285 2:127207192-127207214 CTGTCTCTAAAAAAAATACATGG + Intronic
939823122 2:146981303-146981325 CCGTCTCTACTAAAAATACAAGG + Intergenic
939863001 2:147441611-147441633 GTTTCTATACTAAAAATAAAGGG + Intergenic
939922108 2:148128383-148128405 CCTGTTCTACTAAAAGTACAAGG - Intronic
940197088 2:151106726-151106748 CCTTTTCTACTATAAAGACTGGG - Intergenic
940340265 2:152572735-152572757 CCTTGTCTCCAAAAAATACATGG + Intronic
941341740 2:164314158-164314180 CCTTTTCTATTTCAAATACATGG + Intergenic
941569942 2:167157958-167157980 TCTTCTCCACTGAAAATAAAAGG + Intronic
941994776 2:171592046-171592068 CATTTTCTCCTAAAAATAAAGGG - Intergenic
942018692 2:171843955-171843977 CCATCTCTACTAAAATTAGCCGG - Intronic
943280293 2:185923737-185923759 TCATCTCTACAAAAAATACATGG + Intergenic
943745574 2:191458852-191458874 CCTGCACTACTAAAATAACAAGG - Intergenic
944056956 2:195532271-195532293 CATTCTCTCCTAAAAACACATGG - Intergenic
944453647 2:199871197-199871219 CCTTCTCTACAAAAAGTAGCTGG + Intergenic
944775448 2:202959646-202959668 CTGTCTCTACTAAAAATACCAGG + Intronic
944803968 2:203262848-203262870 CCATCTCTACTAAAAATAGCAGG - Intronic
945091415 2:206179499-206179521 CTGTCTCTACTAAAAATACCTGG - Intronic
945097783 2:206235959-206235981 CTGTCTCTACTAATAATACTTGG - Intergenic
945255879 2:207802589-207802611 CCTTTTCTATGAAAAATACAAGG - Intergenic
945878018 2:215298103-215298125 ACATCTCTACTAAAAATAGCCGG + Intergenic
946675783 2:222157716-222157738 CATTCTATAATAAAAAAACAGGG - Intergenic
947193693 2:227539583-227539605 CCGTTTCTACAAAAAATAAATGG + Intronic
947409622 2:229822581-229822603 TTTTCTCTACCAAAAATAAAGGG - Intronic
948293260 2:236843000-236843022 ATTTCTCAAATAAAAATACAGGG - Intergenic
1168952637 20:1812826-1812848 CCATCTCTACTAAAAATACAAGG + Intergenic
1169568000 20:6876573-6876595 CTTTATCTCCTAAAAATACCAGG - Intergenic
1169728471 20:8761762-8761784 CCGTCTCTACTAAAAATAGCGGG - Intronic
1169842212 20:9951892-9951914 CCATCTCTACTAAAAATACAAGG + Intergenic
1170234137 20:14083259-14083281 CCCTCTCTCCTAAAAATAGCTGG + Intronic
1170450331 20:16476917-16476939 CCATCTCTACTAAAAATACATGG - Intronic
1170565712 20:17602856-17602878 CCATCTCTACTAAAATTAACTGG + Intronic
1170634848 20:18095281-18095303 CTGTCTGTACTAAAAATACAAGG + Intergenic
1170888351 20:20358848-20358870 CCTTTTCTATTCAAAATAGAAGG + Intronic
1171458401 20:25284594-25284616 CTGTCTCTACAAAAAATACAAGG - Intronic
1171725684 20:28618895-28618917 GCTTCTCTGCAAAAAATAAATGG - Intergenic
1171790211 20:29515935-29515957 GCTTCTCTGCAAAAAATAAAGGG - Intergenic
1171857505 20:30360907-30360929 CCTTCTCTGCAAAAAATAAAGGG + Intergenic
1172344505 20:34186982-34187004 CCGTCTCTAGTAAAAATACTAGG - Intergenic
1173238408 20:41270216-41270238 CCGTCTCTACTAAAAATGGCCGG + Intronic
1173995275 20:47333428-47333450 CCGTCTCTACTAAAAATACATGG + Intronic
1174063632 20:47849425-47849447 CCATCTCTACCAAAAATACATGG - Intergenic
1174344655 20:49921329-49921351 CTGTCTCCACAAAAAATACAAGG - Intergenic
1174427731 20:50444695-50444717 CCGTCTCTACTAAAAATACACGG + Intergenic
1174653074 20:52145480-52145502 CCATCTCTACAAAAAATATGTGG + Intronic
1175616799 20:60406786-60406808 CCATTTCTACTAAAAATAGCTGG + Intergenic
1176168025 20:63684641-63684663 CCATTTCTACTAAAAATATCAGG - Intronic
1176456748 21:6919507-6919529 CTGTCTCTACTAAAAGTACTGGG + Intergenic
1176744282 21:10637695-10637717 CCTTCTCTGTTATAAGTACAAGG - Intergenic
1176834921 21:13784567-13784589 CTGTCTCTACTAAAAGTACTGGG + Intergenic
1177546323 21:22562919-22562941 CCGTCTCTACTAAAAATACAAGG - Intergenic
1177703353 21:24667635-24667657 CCTATTCTTGTAAAAATACACGG + Intergenic
1177818735 21:26007778-26007800 TCTTTTCTATTAAAAGTACATGG - Intronic
1178219249 21:30637549-30637571 CCGTTTCTACCGAAAATACAAGG - Intergenic
1178542637 21:33467322-33467344 TCATCTCTTCTAAAAATACAAGG + Intronic
1180558124 22:16593615-16593637 CCTTCTCAAATAAAAAAAAAAGG - Intergenic
1180781826 22:18524729-18524751 CTATCTCTACTGAAAATACAAGG + Intergenic
1181238712 22:21464072-21464094 CTATCTCTACTGAAAATACAAGG + Intergenic
1181940685 22:26473580-26473602 CCGTCTCTACTAAAAATACTGGG + Intronic
1182238599 22:28896432-28896454 CTGTCTCTACTAAAAATATAGGG - Intronic
1182597051 22:31429935-31429957 CCATCTCTACAATAAATAAATGG - Intronic
1182734298 22:32520305-32520327 CCATCTCTACAAAAAAAAAAAGG - Intronic
1183203354 22:36401481-36401503 CCATCTCTACTAACATTACCCGG - Intergenic
1183209112 22:36439503-36439525 CCGTCTCTACTAAAAATACTGGG + Intergenic
1183566329 22:38617822-38617844 ACTTCTCTATTAAAAATTCATGG + Intronic
1183574581 22:38679507-38679529 CCATCTCTATTAAAAATAGCCGG + Intergenic
1183969382 22:41465331-41465353 CCGTCTCTACTAAAAATACGTGG - Intronic
1184427311 22:44418870-44418892 CCTTCTCAAATAAAGAAACAAGG - Intergenic
1184555755 22:45232227-45232249 ACTTCTCTATTATAATTACATGG + Intronic
1184958404 22:47908988-47909010 CCATCTCTACTAAAAATACAAGG - Intergenic
1185390025 22:50554820-50554842 CTGTCTCTATTAAAAATACAAGG + Intronic
949967453 3:9369984-9370006 CCTTATCTACCATATATACACGG + Intronic
950075283 3:10182579-10182601 CCATCTCTACTAAAAATACAAGG - Intronic
951118926 3:18900168-18900190 CCATCTCTACTAAAAATACAAGG + Intergenic
952790295 3:37195135-37195157 CTATCTCTCCTAAAAATAAAAGG - Intergenic
952927584 3:38332626-38332648 CTGTCTCTAGTAAAAGTACAAGG + Intergenic
953559700 3:43977389-43977411 CCGTCTCTACTAAAAATGCCGGG - Intergenic
954362411 3:50129034-50129056 CCGTCTCTACTAAAATTAGCTGG - Intergenic
954666053 3:52253039-52253061 CCATCTCTACTAAAAATATTGGG - Intergenic
955040780 3:55315901-55315923 CTGACTCTACTAAAAATATAAGG - Intergenic
955324190 3:57997083-57997105 CCATCTCTACAAAAAGTACAGGG - Intergenic
955451903 3:59077499-59077521 CCGTCTCTTCTAAAAATACATGG + Intergenic
955853744 3:63250304-63250326 ACATGTCAACTAAAAATACAAGG + Intronic
956365644 3:68499348-68499370 CCCTCTCTACTAAGAATTCAAGG - Intronic
956717139 3:72088447-72088469 CTGCCTCTACTAAAGATACAAGG + Intergenic
956768980 3:72508390-72508412 CCGTCTCTACTAAAAATAGCCGG + Intergenic
956841199 3:73141945-73141967 CCGTCTCTACTAAAAATAGCCGG - Intergenic
957806052 3:85150728-85150750 CCGTCTCTACTAAAAAAAAAAGG + Intronic
957851964 3:85819580-85819602 CCTTCTCTACCATAAATGGATGG - Intronic
960210652 3:114961286-114961308 CCTTCAATACAAAAAATAAAAGG + Intronic
960589696 3:119353630-119353652 CTGTCTCTACTAAAAATACATGG + Intronic
961250707 3:125502696-125502718 CCATCTCTACTAAAACTACATGG + Intronic
961257105 3:125565071-125565093 CCATCTCTACAAAAACTAAAAGG + Intronic
961439354 3:126943554-126943576 CTTTCTATCCTAAAAACACATGG + Intronic
961753323 3:129110664-129110686 CCGTCTCTATTAAAAATGCCAGG + Intronic
961769969 3:129241844-129241866 CCGTCTCTACTAAAATTAGCTGG + Intergenic
962521699 3:136203043-136203065 CTGTCTCTACTAAAAATTCGTGG - Intergenic
962559276 3:136589059-136589081 CCATGTCTATTAAAAATACAAGG - Intronic
963374668 3:144448921-144448943 CCTTCTCTATAAAGGATACATGG + Intergenic
963704596 3:148670242-148670264 CCATCTCTACTAAAAACACAGGG - Intergenic
963977863 3:151502950-151502972 CCTTCTCTACTTGAAGTAGAAGG + Intergenic
964136826 3:153353680-153353702 CTGTCTATACTAAAAATACAGGG + Intergenic
964399860 3:156287654-156287676 CTATCTCTACTAAAAATACAAGG + Intronic
964758517 3:160111073-160111095 CTGTCTCTACTAAAAATACCTGG - Intergenic
965319980 3:167241449-167241471 CATTCAATACTAAAAATATAAGG - Intronic
966243321 3:177778725-177778747 CATTCTCTACTGAAAGAACAAGG + Intergenic
966712465 3:182983543-182983565 CCATCTCTACTAAAATTAACCGG + Intronic
966762817 3:183432216-183432238 CCGCCTCTCCTAAAAATACCCGG + Intergenic
966788440 3:183641320-183641342 CCGTCTCTACTAAAAATACATGG + Intronic
966791272 3:183672692-183672714 CCGTCTCTACTAAAAAATTATGG + Intronic
966801679 3:183769855-183769877 TCATCTCTACTAAAATTACAAGG - Intronic
967038931 3:185671373-185671395 CCTTCTCTACTAAAATTAGCTGG + Intronic
967059076 3:185855432-185855454 TCATCTCTACAAAAAATACAAGG + Intergenic
967548126 3:190756901-190756923 CTGCCTCTACAAAAAATACAAGG - Intergenic
967815480 3:193794815-193794837 CCTTCCCTAATAGAAATACACGG - Intergenic
968158391 3:196403014-196403036 TCTTCTCTATTAAAAAAAAATGG + Exonic
968159736 3:196416267-196416289 CCATCTCTACAAAAATTACCCGG + Intronic
968388962 4:172881-172903 CCGTCTCTACTAAAATTAGATGG + Intergenic
968814762 4:2816208-2816230 CCATTTCTACTAAAAATACCAGG - Intronic
968946986 4:3670260-3670282 CCTTCCCCAGTAAAAATAAAAGG + Intergenic
969047199 4:4345004-4345026 CCGTCTCTACTAAAATTAGCTGG - Intergenic
969122739 4:4921862-4921884 CCGTCTCTACTAAAAATACATGG - Intergenic
970305810 4:14731388-14731410 CTTTCTCTACCAAAAATATATGG + Intergenic
970557837 4:17253575-17253597 CCATCTCTACTAAAAATACAAGG + Intergenic
970613626 4:17747619-17747641 CCGCCTCTATTAAAAATTCAAGG + Intronic
971291913 4:25350437-25350459 CTGTCTCTACTAAAAATACAGGG - Intronic
971292105 4:25352584-25352606 CTGTCTCTACTAAAAATACAGGG - Intronic
971690291 4:29825382-29825404 CTGTCTCTACTAAAAATATAAGG - Intergenic
973093221 4:46164389-46164411 CCGTCTCTACTAAAAATACAAGG - Intergenic
973333599 4:48934082-48934104 CCTTCTCTACCAGAAATTCAAGG - Intergenic
974043278 4:56876313-56876335 CCATCTCTACTAAATATACAAGG + Intergenic
974044115 4:56883211-56883233 CTTTTTCTATTAAAAATACTTGG - Intergenic
974608179 4:64180758-64180780 CTTTGTCTACTAAAAATGCTTGG - Intergenic
976120142 4:81771242-81771264 CATTCTTTACCAAAAATAAATGG + Intronic
976289798 4:83405775-83405797 CCTTCTCTACAAAAATTAGCTGG + Intergenic
976729845 4:88250731-88250753 CAGTCTTTACTAAAAATACAAGG - Intergenic
977147911 4:93469156-93469178 CCTTCTCTACCAAAAGCACCAGG - Intronic
977757612 4:100691505-100691527 CCGTCTCTACTAAAATTAGCCGG + Intronic
977794069 4:101141489-101141511 CATGCTCTCCTAAAAATACCAGG + Intronic
978099984 4:104826742-104826764 CTTTCTGTAGTAAAAATACCTGG - Intergenic
978897314 4:113904423-113904445 TCTTAAGTACTAAAAATACAAGG + Intronic
979047359 4:115885364-115885386 CCTTATCTTCTAAAGCTACAAGG - Intergenic
979718050 4:123865452-123865474 AGATCTCTACTAAAAATAAAAGG - Intergenic
980039997 4:127928210-127928232 ATTTTTCTACTAAAAATAGAGGG - Intronic
980040001 4:127928264-127928286 ATTTTTCTACTAAAAATACAGGG - Intronic
980837357 4:138212603-138212625 CCTTCTCTTCTTAAATTAAAGGG - Intronic
980877856 4:138679973-138679995 CCGTCTCTACTAAAATTAGTGGG + Intergenic
980939009 4:139254964-139254986 CCGTCTCTACTAAAAATACAAGG - Intergenic
981663351 4:147193477-147193499 ACTTCTCTAATAAGAATTCAGGG + Intergenic
981746951 4:148061456-148061478 CCTTTTCTGCTAAAAAAAAATGG + Intronic
982015349 4:151147921-151147943 CCCTCTCTACAGTAAATACATGG - Exonic
982244573 4:153338132-153338154 CTTCCACTACTAAATATACAGGG + Exonic
982654853 4:158135158-158135180 CCATCTCTACTAAAGATACCGGG + Intronic
983041910 4:162939023-162939045 CTTTCTCCTCTAAAAATATAGGG - Intergenic
983238371 4:165205779-165205801 CCGTCTCTTCTAAAAATAGCCGG - Intronic
983604167 4:169566931-169566953 CCGTCTCTACAAAAAATAGCTGG + Intronic
985250928 4:188023578-188023600 CCATCTCTACTAAAACTACGTGG + Intergenic
985434528 4:189916348-189916370 GCTTCTCTGCAAAAAATAAAGGG + Intergenic
985616392 5:924684-924706 CTGTCTCTACTAAAAATAAAAGG - Intergenic
985998559 5:3612022-3612044 CTGTCTCTACTAAAAATACATGG - Intergenic
987338390 5:16917685-16917707 CCATCTCTACAAAAAAAAAAAGG + Intronic
987825012 5:23020209-23020231 CTGTCTCTACTAAAAGAACAGGG - Intergenic
987941788 5:24548288-24548310 CCATCTCTACTAAAAATACATGG - Intronic
989024988 5:37057102-37057124 CCTTTTTTAGAAAAAATACAGGG - Intronic
989578348 5:43009590-43009612 CCGTCTCTACAAAAAATTCTGGG + Intergenic
991131950 5:63132655-63132677 GCATCTATACTAAAAATTCAGGG - Intergenic
992594538 5:78332309-78332331 CCCTCTCTACTAAAAAAATTAGG + Intergenic
992714002 5:79491259-79491281 CCATCTCTACAAAAAATAGCCGG + Intronic
994138341 5:96314511-96314533 CCTTCTCTGCTACACAAACATGG + Intergenic
994164247 5:96592226-96592248 CTGTCTCTGCTAGAAATACAGGG + Intronic
994289804 5:98015205-98015227 CCCTCACTACTCAAAATACTTGG - Intergenic
994702394 5:103151672-103151694 CCTTTTCCACTATAACTACATGG - Intronic
995026133 5:107424859-107424881 CTTTCATTACTAAAAAGACAGGG + Intronic
995463010 5:112421908-112421930 TTGTCTCTACTAAAAATACAGGG - Intergenic
995721540 5:115139545-115139567 CCTTCTCTTTTAAAAATATGTGG - Intronic
996582703 5:125049086-125049108 CCATCTCTACAAAAAATAGCTGG - Intergenic
996719657 5:126617782-126617804 CCGTCTCTACAAAGAATAAAAGG - Intronic
996981699 5:129503666-129503688 CCATCTCTACTAAAAATATGTGG + Intronic
997327823 5:133036610-133036632 CTGTCTCTATTAAAAATACAGGG + Intergenic
997966171 5:138358151-138358173 CCATCTCTACTAAAATTACATGG - Intronic
998117226 5:139547384-139547406 GCGTCTCTACTAAAAATACATGG - Intronic
998305214 5:141069387-141069409 CTGTCTCTACTAAAAATAGCCGG - Intergenic
998526216 5:142845599-142845621 CTTCCTTTTCTAAAAATACACGG - Intronic
998682563 5:144486601-144486623 CTTTCTGTACAAGAAATACAAGG - Intergenic
998824312 5:146085245-146085267 CCATCTCTACTAAAATAATATGG + Intronic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
999536731 5:152525641-152525663 CCTTCTCTACTAAAATCACAGGG + Intergenic
1000432780 5:161169707-161169729 ACTTATCAACTAAAAATAGAAGG - Intergenic
1001281114 5:170387126-170387148 CCATTTCTACCAAAAATACCAGG + Intronic
1001508598 5:172300628-172300650 CCTTCTCTGTTAAAACAACAAGG - Intergenic
1002260084 5:177987170-177987192 CCGTGTCTACTAAAGATACTGGG - Intergenic
1002593853 5:180309580-180309602 CCATCTCTACTAAAAATAGCTGG - Intronic
1002656453 5:180752274-180752296 CATACTCTACTAAAAGTAGATGG + Intergenic
1002715830 5:181226574-181226596 CAATCTCTGCTAAAAATGCAGGG - Intronic
1002977853 6:2102920-2102942 CCTACACTACTAAAAATATTAGG + Intronic
1003088203 6:3078321-3078343 CCCTCTCTACAAAAAATAAAAGG + Intronic
1003412653 6:5879268-5879290 CCGTCTCTGCAAAAAATAGATGG - Intergenic
1003463988 6:6359919-6359941 ACTTTTTTACTAAACATACAAGG - Intergenic
1003639995 6:7868581-7868603 CCTTCTCTCCTAGAATGACAAGG - Intronic
1003777699 6:9387509-9387531 CCTTCTCTACTAAAATTAGCTGG - Intergenic
1004321946 6:14638834-14638856 GCATCTCTTCTAAAAATACGAGG - Intergenic
1004366278 6:15015650-15015672 CCATTTCTACTAAAAATACATGG - Intergenic
1004372176 6:15062056-15062078 CCATCTCTACAAAAAATAACAGG - Intergenic
1004414043 6:15408091-15408113 CCATCTCTACAAAAAATACAAGG + Intronic
1004676629 6:17849071-17849093 CCATCTCTACTAAAAAGGCACGG - Intronic
1004975855 6:20965298-20965320 TCTTCTCTTCTCAAGATACAGGG - Intronic
1005485470 6:26295188-26295210 CCATCTCTACTAAAAATGCAAGG - Intergenic
1005750187 6:28875015-28875037 CCATCTCTACTAAAAATACCTGG + Intergenic
1005761782 6:28974137-28974159 CCATCTCTACTAAAAATACATGG - Intergenic
1006329747 6:33381909-33381931 ACTTCTCTACTAAAAAAAGAAGG - Intergenic
1006476124 6:34255334-34255356 CCGTCTTTACTAAAAATAGCCGG + Intergenic
1006483077 6:34314250-34314272 CCATCTCTACTGAAAATATAAGG + Intronic
1006922708 6:37637070-37637092 CCTTCTTTACTGCAAAGACAGGG - Exonic
1007190716 6:40015451-40015473 CCATCTCTACTAAAAATATTTGG - Intergenic
1007576999 6:42931529-42931551 CCGTCTCTACTAAAAATAGCCGG - Intronic
1008637127 6:53421920-53421942 CCATCTCTACTAAAAATAGTAGG - Intergenic
1008672510 6:53785826-53785848 CCATCTCTACTAAAAATACATGG - Intergenic
1009242156 6:61196561-61196583 CCATCTCTACTAAAAATACAAGG - Intergenic
1009478142 6:64120951-64120973 ACTTCTCTCCTACAAATGCAAGG - Intronic
1010026093 6:71219034-71219056 ACTTCTGTACTTAAAATAGAGGG + Intergenic
1010216900 6:73411012-73411034 CCGTCTCTACTAAATTTACCCGG + Intronic
1010693040 6:78933287-78933309 CCATCTCTAATAAAAGTGCAAGG - Intronic
1010966450 6:82214564-82214586 CCTTCTCTACCACAAAGAGATGG + Exonic
1011047720 6:83104452-83104474 CATTCTCTACTAAACAAAGATGG - Intronic
1012295207 6:97513550-97513572 CCTACTCCACTAAGAACACAAGG + Intergenic
1012863883 6:104595062-104595084 TCATCTCTACAAAAAATACAGGG + Intergenic
1013522774 6:110947977-110947999 CCATCTCCACTAAAAATAGCTGG + Intergenic
1015226116 6:130859348-130859370 CAGTCTCTACTAAAAACACCAGG + Intronic
1015818927 6:137239444-137239466 CCATCTCTACAAAAAATAGCTGG + Intergenic
1015975221 6:138783736-138783758 TCATCTCTATAAAAAATACAAGG - Intronic
1017680233 6:156856492-156856514 GCTTCTCCACTAGAAATACTTGG - Intronic
1018018432 6:159733741-159733763 CCGTCTCTACTAAAAATACAAGG + Intronic
1018140130 6:160823782-160823804 CCTGCTATTCTAAAAATATATGG + Intergenic
1018242028 6:161786930-161786952 CGTTTTCCAGTAAAAATACATGG - Intronic
1018264864 6:162013443-162013465 TTTTCTCCACTAAAAATACTAGG - Intronic
1019569201 7:1701637-1701659 CCTTCTCTAAAAAAAATTAATGG + Intronic
1019926034 7:4192445-4192467 CTGTCTCTACTAAAAATACAAGG - Intronic
1020072416 7:5235881-5235903 CCGTCTCTACTAAAAATACATGG + Intergenic
1020163840 7:5793229-5793251 CTCTCTCTACAAAAAATAAAAGG + Intergenic
1020182309 7:5931826-5931848 CCCCATCTACTAAAAATACAAGG + Intronic
1020300601 7:6792931-6792953 CCCCATCTACTAAAAATACAAGG - Intronic
1020930486 7:14387249-14387271 CCGTCTCTACTAAAATTAGCTGG + Intronic
1021748259 7:23766422-23766444 CCATCTCTACTAAAATTAGCCGG - Intronic
1021897295 7:25249451-25249473 CTGTCTCTACTAAAAATGCATGG - Intergenic
1022459032 7:30586677-30586699 CCGTCTCTACTAAAAATACATGG + Intergenic
1022616371 7:31935103-31935125 CCTTCTCTAGTAAGAGAACATGG + Intronic
1022988666 7:35685806-35685828 TCATCTCTACTAAAAATACGTGG + Intronic
1023427064 7:40049031-40049053 CCATCTCTACTAAAAATAGCTGG + Intronic
1024245037 7:47463081-47463103 CCGTCTCTAGGAGAAATACAGGG + Intronic
1025608565 7:63057111-63057133 CCATCTCTACTAAAAAGAAAAGG - Intergenic
1025610014 7:63069912-63069934 CCGTCTCTACTAAAAATAGCTGG - Intergenic
1026120735 7:67534783-67534805 CCGTCTCTACTAAAATTAGCTGG - Intergenic
1026680540 7:72463320-72463342 CCATCTGTACTAAAAGTACCTGG - Intergenic
1027170840 7:75871177-75871199 CCGTCTCTACTAAAAATACATGG + Intronic
1027657561 7:80949720-80949742 CCTTCTCCTCTAATAATAAATGG + Intergenic
1027745803 7:82072409-82072431 AATACTCTCCTAAAAATACATGG - Intronic
1028740001 7:94263180-94263202 CTCTCTCTACTAAAAAAAAAAGG - Intergenic
1029264936 7:99331231-99331253 CCATCTCTACAAAAATTACCTGG + Intronic
1030001538 7:105069182-105069204 CTTTGTCTACTAAAAAGACTAGG - Intronic
1030150060 7:106395355-106395377 CCATCTCTACTTAAAAAAAATGG + Intergenic
1030649486 7:112102002-112102024 CCATCTCTACTAAAATTAGCTGG - Intronic
1031392694 7:121235153-121235175 CAGTCTCCACTAAAAATAAATGG + Intronic
1032241961 7:130169064-130169086 CCGTCTCTACCAAAAATACCCGG + Intronic
1032345742 7:131114773-131114795 CCATCTCTACTAAAATTAGCCGG + Intronic
1032357209 7:131222065-131222087 CCATCTCTACTAAAATTAGCCGG - Intronic
1032529777 7:132610487-132610509 CCATCCCTGCTAAAAATAAAAGG + Intronic
1033180805 7:139175987-139176009 CTGTCTCTACTAAAAATACCGGG - Intronic
1033198510 7:139348205-139348227 CCATCTCTATTAAAAAAAAAAGG - Intronic
1033364032 7:140657834-140657856 CTGTCTCTACTAAAAATACTCGG + Intronic
1033724104 7:144094585-144094607 TCTCCTCTACTTCAAATACATGG - Intergenic
1034519122 7:151605185-151605207 CCGTCTCTACTAAAAATACAAGG - Intronic
1036110014 8:5888011-5888033 CTGTCTCTACTAAAAATACCCGG - Intergenic
1036450169 8:8859180-8859202 CCGTCTCTACAAAAATTACATGG + Intronic
1037024722 8:14020524-14020546 CTTTGTCTACTAAAAAGACCTGG - Intergenic
1037252542 8:16913358-16913380 CCATCACTCCTAAAGATACAAGG - Intergenic
1037489014 8:19378872-19378894 CCATCTCTACAAAAAAAACATGG + Intronic
1037550911 8:19970462-19970484 CCTTATTTACTGAGAATACAGGG + Intergenic
1037681820 8:21103995-21104017 CCTTCTCTACTAAAAATGCCAGG + Intergenic
1038285134 8:26199627-26199649 CCATCTCTACTAAAATTAGCTGG - Intergenic
1038577826 8:28720473-28720495 CCTTCTCCACTTAAAATAGCTGG - Intronic
1038796412 8:30714369-30714391 CTGTCTCTACTAAAAATACCAGG - Intronic
1039350864 8:36762122-36762144 CCTTTTCTAATAAAAATACCAGG - Intergenic
1039607354 8:38892516-38892538 CTGTCTCTACTAAAAATACATGG - Intergenic
1039640999 8:39221363-39221385 TATTCTCTACTTAAAAGACATGG - Intronic
1039767025 8:40639570-40639592 ACTTTTCTACAAAAAATAAAGGG + Intronic
1040350857 8:46566037-46566059 CCTTCTATCATAAAGATACATGG + Intergenic
1040801019 8:51340164-51340186 CTTTCTCTATTATAAATTCATGG + Intronic
1041046882 8:53895815-53895837 CTATTTCTACTAAAAATACAAGG - Intronic
1041056325 8:53990227-53990249 CTTTCTCTACCAAAAAAAAAAGG - Intronic
1041091633 8:54306882-54306904 CCGTCTCTACCAAAAATAGCTGG + Intergenic
1041252696 8:55949554-55949576 CCATGTCAACTAAAAATAAAAGG - Intronic
1041563563 8:59248664-59248686 ACTTATCCACTAAAAATAAAAGG + Intergenic
1042392227 8:68249112-68249134 CTGTCTCTACTAAAAATACTGGG - Intergenic
1042821651 8:72936408-72936430 CCTTCTCAGCAAAAAATACCAGG - Exonic
1042985583 8:74579603-74579625 ACTTCTCTGCTAAAAACACCAGG - Intergenic
1043170062 8:76954594-76954616 CCTTCTCTCATAAACTTACATGG + Intergenic
1043170064 8:76954643-76954665 CCTTCTCTCATAAACTTACATGG - Intergenic
1043278508 8:78432827-78432849 GTGTCTCTACTAAAAATACCGGG + Intergenic
1043427960 8:80167142-80167164 ATTTTTCTAATAAAAATACATGG + Intronic
1043855059 8:85255489-85255511 CTGTCTCTACTAAAAATGCCAGG - Intronic
1043938223 8:86167624-86167646 TCGTCTCTACTAAAAATATGTGG + Intergenic
1044007111 8:86951416-86951438 CCATCTCTACTAAAAGTAGCTGG + Intronic
1044175875 8:89121584-89121606 CCTGTTCCATTAAAAATACAAGG - Intergenic
1044602769 8:94022202-94022224 CCGTCTCTACTAAAAATACAAGG + Intergenic
1044617028 8:94152835-94152857 CCTTCTCTACTAAAAATAAAAGG - Intronic
1045365909 8:101475990-101476012 CCATCTCTACTAAAAATACTGGG + Intergenic
1045613110 8:103871236-103871258 CCATCTGTACTAAAAATATGCGG + Intronic
1045758930 8:105580402-105580424 CTTTTTCTAGGAAAAATACAAGG + Intronic
1045990337 8:108298989-108299011 CCGTCTCTACAAAAAAAATATGG - Intronic
1046530797 8:115442789-115442811 CTGTCTCTACTAAAAAAAAAAGG + Intronic
1046551398 8:115722621-115722643 CTGTCTCTTCTAAAAATACAAGG - Intronic
1047246403 8:123148883-123148905 TCGTCTCTACTAAAAATAGCCGG + Intronic
1047485109 8:125322886-125322908 CCATCTCTACTAAAAATACAAGG + Intronic
1047917754 8:129600980-129601002 CAATTTCTACTAAAAATACAAGG - Intergenic
1048147828 8:131862738-131862760 CCGTCTCTACTAAAAATACTGGG + Intergenic
1049214153 8:141400067-141400089 CCATCTCTACAAAAAATAGCTGG - Intronic
1050359763 9:4818708-4818730 CTGTCTCTACTAAAAATAGCTGG + Intronic
1050886849 9:10777582-10777604 CCATCTCTATTAAAACAACATGG - Intergenic
1051109277 9:13617088-13617110 CCATCTCTACAAAAAAGGCAGGG - Intergenic
1052679025 9:31664698-31664720 AATTCTCTATTAAAAATACTTGG - Intergenic
1052972776 9:34387169-34387191 CCATCTCTATGAAAAATACCAGG - Intronic
1053248564 9:36555524-36555546 CTGTCTCTACTAAAAATAGCTGG - Intergenic
1053445294 9:38148365-38148387 CCATCTCTACCAAAAAAAGAAGG - Intergenic
1053484389 9:38441132-38441154 CCATCTCTACAAAAAATAAAAGG - Intergenic
1053723605 9:40974441-40974463 GCTTCTCTGCAAAAAATAAAGGG + Intergenic
1053723927 9:40976973-40976995 GCTTCTCTGCAAAAAATAAATGG + Intergenic
1054342035 9:63875026-63875048 GCTTCTCTGCAAAAAATAAATGG - Intergenic
1054342356 9:63877555-63877577 GCTTCTCTGCAAAAAATAAAGGG - Intergenic
1054735788 9:68748780-68748802 CCGTCTCTACTAAAAATAGCAGG - Intronic
1055105869 9:72512234-72512256 CCATCTCTACTAAAAATACCAGG + Intergenic
1055469617 9:76598284-76598306 CCATCTCTACTAAAAGGACAAGG + Intergenic
1055667922 9:78570800-78570822 ACTTCTCTATTAAAACTCCATGG + Intergenic
1055861084 9:80749574-80749596 CTTTATTTGCTAAAAATACAGGG + Intergenic
1056164674 9:83929612-83929634 CCATCTCTACTAAAAATACTGGG - Intergenic
1056292013 9:85153175-85153197 CCATCTCTACTAAAAATAAAAGG - Intergenic
1057086298 9:92213971-92213993 CCATCTCTACTAAAATTAGCTGG - Intronic
1057093726 9:92284612-92284634 CTGTCTCTACTAAAAATGCGTGG + Intronic
1057435284 9:95034682-95034704 CTTTCCCTATTAAAAACACAAGG - Intronic
1057564959 9:96159664-96159686 AGTTCTCTACCAAAAACACATGG - Intergenic
1059100297 9:111465011-111465033 CCGTCTCTACTAAAAATACAAGG + Intronic
1059209402 9:112498623-112498645 CCATCTCAACTAAAAATAAAAGG - Intronic
1060395028 9:123310179-123310201 CCATCTCTACTAAAAATACAAGG - Intergenic
1060604699 9:124903315-124903337 CTATCTCTGCTAAAAATACAAGG + Intronic
1061316630 9:129800352-129800374 CCGTCTCTACTAAAAACAGATGG + Intergenic
1061455299 9:130693102-130693124 CCTTCCCTACCAAATATACCTGG + Intergenic
1061928172 9:133817480-133817502 CCATCTCTACTAAAAATACTCGG + Intronic
1062125748 9:134861160-134861182 CCATCTCTACTAAAAATACATGG + Intergenic
1062458554 9:136652988-136653010 CCATCTCTACTAAAATTAGCCGG + Intergenic
1062530845 9:136999200-136999222 CTGTCTCTACTACAAATACAAGG - Intergenic
1062539831 9:137036615-137036637 CCATCTCCACTAAAAATAGCTGG + Exonic
1203451238 Un_GL000219v1:119024-119046 GCTTCTCTGCAAAAAATAAATGG - Intergenic
1185578564 X:1192982-1193004 CCATCTCTACTAAAAATACAAGG - Intronic
1185647113 X:1623731-1623753 CTGTCTCTATTAAAAATACGTGG - Intronic
1185647127 X:1623817-1623839 CTGTCTCTACTAAAAATAAGTGG - Intronic
1186034836 X:5411227-5411249 CTTTCTCTACTACAAAGTCATGG - Intergenic
1186804438 X:13126064-13126086 CTGTCTCTACTAAAAATACATGG - Intergenic
1187912894 X:24127156-24127178 CCTTCTCTACTAAAATTAGCTGG - Intergenic
1189400249 X:40661380-40661402 CTATCTCTACTGAAAATACAAGG - Intronic
1189427638 X:40915670-40915692 CCATCTCTACTAAAAATACCAGG - Intergenic
1189500488 X:41551722-41551744 CTGTCTCTACTAAAAATATGTGG + Intronic
1189543895 X:42021774-42021796 CCATCTCTACTAAAAATAAAAGG - Intergenic
1190003035 X:46707908-46707930 CCTTCTCTACTAAAAATACAAGG - Intronic
1190086384 X:47398840-47398862 CTGTCTCTACTAAAAATACTGGG - Intronic
1190389746 X:49920330-49920352 CCATCTCTACTAAAAATACATGG - Intergenic
1190676751 X:52789250-52789272 CCGTCTCTACCAAAAATACCTGG - Intronic
1190731465 X:53229161-53229183 CATTCTCTACTAAAAAGAACCGG + Intergenic
1190885161 X:54525205-54525227 CCGTCTCTACTAAAAATACACGG + Intergenic
1191078245 X:56480127-56480149 GCTTGTCTAATAAAAATATAAGG - Intergenic
1192327703 X:70147259-70147281 CCCCCTCTACTAAAAATAGCCGG + Intronic
1193127456 X:77884898-77884920 CCGTCTCTACTAAAATTAGCCGG + Intronic
1194764371 X:97832176-97832198 CATTCTCTACTAAAAAGAACCGG - Intergenic
1195327774 X:103771866-103771888 GATTCACTAATAAAAATACAAGG + Intergenic
1195646915 X:107242426-107242448 CCTTCTCTACTGAAAATGCGAGG + Intronic
1196534829 X:116831278-116831300 ACTTCTCTACTTAGAGTACAGGG - Intergenic
1196667265 X:118329841-118329863 CCATCTCTACTAAAAATAGCCGG - Intergenic
1196695946 X:118611913-118611935 CTGTCTCTACTAAAAATACTGGG - Intronic
1196908728 X:120464911-120464933 CCATCTCTACTAAAAATACAAGG - Intronic
1197527898 X:127584303-127584325 CTTTCTCTCATAACAATACATGG + Intergenic
1197563873 X:128057147-128057169 CTGTCTCTACTAAAAATAGCTGG + Intergenic
1198246631 X:134838473-134838495 CCGTCTCTACTAAAATTAGCTGG - Intronic
1198471200 X:136948765-136948787 CCATCTCTACTAAAAATACGGGG - Intergenic
1198755231 X:139975403-139975425 CATTATCTAATAAAAATAGAGGG - Intergenic
1199756225 X:150867591-150867613 CTGTCTCTAATAAAACTACATGG + Intronic
1201284139 Y:12364634-12364656 CTGCCTCTACAAAAAATACAAGG - Intergenic