ID: 1190023792

View in Genome Browser
Species Human (GRCh38)
Location X:46903779-46903801
Sequence TGGGAGTCCCAGCGGTACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190023785_1190023792 4 Left 1190023785 X:46903752-46903774 CCCATGGGAACACCAGACAGGAT No data
Right 1190023792 X:46903779-46903801 TGGGAGTCCCAGCGGTACCAGGG No data
1190023780_1190023792 16 Left 1190023780 X:46903740-46903762 CCGCCTTCTTCCCCCATGGGAAC No data
Right 1190023792 X:46903779-46903801 TGGGAGTCCCAGCGGTACCAGGG No data
1190023789_1190023792 -8 Left 1190023789 X:46903764-46903786 CCAGACAGGATTGAGTGGGAGTC No data
Right 1190023792 X:46903779-46903801 TGGGAGTCCCAGCGGTACCAGGG No data
1190023782_1190023792 6 Left 1190023782 X:46903750-46903772 CCCCCATGGGAACACCAGACAGG No data
Right 1190023792 X:46903779-46903801 TGGGAGTCCCAGCGGTACCAGGG No data
1190023781_1190023792 13 Left 1190023781 X:46903743-46903765 CCTTCTTCCCCCATGGGAACACC No data
Right 1190023792 X:46903779-46903801 TGGGAGTCCCAGCGGTACCAGGG No data
1190023786_1190023792 3 Left 1190023786 X:46903753-46903775 CCATGGGAACACCAGACAGGATT No data
Right 1190023792 X:46903779-46903801 TGGGAGTCCCAGCGGTACCAGGG No data
1190023784_1190023792 5 Left 1190023784 X:46903751-46903773 CCCCATGGGAACACCAGACAGGA No data
Right 1190023792 X:46903779-46903801 TGGGAGTCCCAGCGGTACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190023792 Original CRISPR TGGGAGTCCCAGCGGTACCA GGG Intergenic
No off target data available for this crispr