ID: 1190023887

View in Genome Browser
Species Human (GRCh38)
Location X:46904223-46904245
Sequence TGACATGGCAACAGTGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190023887_1190023896 25 Left 1190023887 X:46904223-46904245 CCCTCCCCACTGTTGCCATGTCA No data
Right 1190023896 X:46904271-46904293 CTTTCACCCTTATCTGCCAGTGG No data
1190023887_1190023894 -6 Left 1190023887 X:46904223-46904245 CCCTCCCCACTGTTGCCATGTCA No data
Right 1190023894 X:46904240-46904262 ATGTCAGTGGAGACTGAGTGAGG No data
1190023887_1190023895 1 Left 1190023887 X:46904223-46904245 CCCTCCCCACTGTTGCCATGTCA No data
Right 1190023895 X:46904247-46904269 TGGAGACTGAGTGAGGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190023887 Original CRISPR TGACATGGCAACAGTGGGGA GGG (reversed) Intergenic
No off target data available for this crispr