ID: 1190024569

View in Genome Browser
Species Human (GRCh38)
Location X:46912216-46912238
Sequence CCGCGGCGCCGCGTTCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 69}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190024569_1190024577 -4 Left 1190024569 X:46912216-46912238 CCACCTGGAACGCGGCGCCGCGG 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1190024577 X:46912235-46912257 GCGGGTGCGGGAGCGGCGAGTGG 0: 1
1: 0
2: 4
3: 57
4: 497
1190024569_1190024586 20 Left 1190024569 X:46912216-46912238 CCACCTGGAACGCGGCGCCGCGG 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1190024586 X:46912259-46912281 CGGGGCGTCGAGGCGGCGGGTGG 0: 1
1: 0
2: 2
3: 32
4: 446
1190024569_1190024581 2 Left 1190024569 X:46912216-46912238 CCACCTGGAACGCGGCGCCGCGG 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1190024581 X:46912241-46912263 GCGGGAGCGGCGAGTGGGCGGGG 0: 1
1: 0
2: 5
3: 44
4: 498
1190024569_1190024580 1 Left 1190024569 X:46912216-46912238 CCACCTGGAACGCGGCGCCGCGG 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1190024580 X:46912240-46912262 TGCGGGAGCGGCGAGTGGGCGGG 0: 1
1: 0
2: 2
3: 15
4: 239
1190024569_1190024587 26 Left 1190024569 X:46912216-46912238 CCACCTGGAACGCGGCGCCGCGG 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1190024587 X:46912265-46912287 GTCGAGGCGGCGGGTGGCGACGG 0: 1
1: 0
2: 0
3: 15
4: 195
1190024569_1190024584 16 Left 1190024569 X:46912216-46912238 CCACCTGGAACGCGGCGCCGCGG 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1190024584 X:46912255-46912277 TGGGCGGGGCGTCGAGGCGGCGG 0: 1
1: 0
2: 2
3: 43
4: 411
1190024569_1190024583 13 Left 1190024569 X:46912216-46912238 CCACCTGGAACGCGGCGCCGCGG 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1190024583 X:46912252-46912274 GAGTGGGCGGGGCGTCGAGGCGG 0: 1
1: 0
2: 4
3: 26
4: 349
1190024569_1190024578 -3 Left 1190024569 X:46912216-46912238 CCACCTGGAACGCGGCGCCGCGG 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1190024578 X:46912236-46912258 CGGGTGCGGGAGCGGCGAGTGGG 0: 1
1: 0
2: 3
3: 14
4: 164
1190024569_1190024579 0 Left 1190024569 X:46912216-46912238 CCACCTGGAACGCGGCGCCGCGG 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1190024579 X:46912239-46912261 GTGCGGGAGCGGCGAGTGGGCGG 0: 1
1: 0
2: 0
3: 17
4: 271
1190024569_1190024585 17 Left 1190024569 X:46912216-46912238 CCACCTGGAACGCGGCGCCGCGG 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1190024585 X:46912256-46912278 GGGCGGGGCGTCGAGGCGGCGGG 0: 1
1: 0
2: 3
3: 78
4: 562
1190024569_1190024582 10 Left 1190024569 X:46912216-46912238 CCACCTGGAACGCGGCGCCGCGG 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1190024582 X:46912249-46912271 GGCGAGTGGGCGGGGCGTCGAGG 0: 1
1: 0
2: 2
3: 46
4: 379

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190024569 Original CRISPR CCGCGGCGCCGCGTTCCAGG TGG (reversed) Intergenic