ID: 1190029912

View in Genome Browser
Species Human (GRCh38)
Location X:46962129-46962151
Sequence GTGGCTGCCCAGGAAGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 462
Summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 411}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190029903_1190029912 19 Left 1190029903 X:46962087-46962109 CCAGTTATTCGAAGCACCTGCGC 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1190029912 X:46962129-46962151 GTGGCTGCCCAGGAAGATGGAGG 0: 1
1: 0
2: 3
3: 47
4: 411
1190029909_1190029912 -6 Left 1190029909 X:46962112-46962134 CCTCACAGGGTCTTGTTGTGGCT 0: 1
1: 0
2: 1
3: 18
4: 161
Right 1190029912 X:46962129-46962151 GTGGCTGCCCAGGAAGATGGAGG 0: 1
1: 0
2: 3
3: 47
4: 411
1190029907_1190029912 -3 Left 1190029907 X:46962109-46962131 CCTCCTCACAGGGTCTTGTTGTG 0: 1
1: 0
2: 1
3: 18
4: 187
Right 1190029912 X:46962129-46962151 GTGGCTGCCCAGGAAGATGGAGG 0: 1
1: 0
2: 3
3: 47
4: 411
1190029906_1190029912 3 Left 1190029906 X:46962103-46962125 CCTGCGCCTCCTCACAGGGTCTT 0: 1
1: 0
2: 1
3: 11
4: 216
Right 1190029912 X:46962129-46962151 GTGGCTGCCCAGGAAGATGGAGG 0: 1
1: 0
2: 3
3: 47
4: 411

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190029912 Original CRISPR GTGGCTGCCCAGGAAGATGG AGG Intronic
900463954 1:2814896-2814918 GATGCGGCCCAGGAAGATGCAGG - Intergenic
900971874 1:5996347-5996369 GTGGGTGTGCAGGAAGAGGGAGG - Intronic
901089772 1:6633469-6633491 GCGGCTGTCCAGGCTGATGGAGG - Exonic
901677140 1:10892100-10892122 GTGACAGTCCAGGATGATGGTGG - Intergenic
901759784 1:11463265-11463287 GTTGCTTCCCAGGAAAGTGGCGG - Intergenic
902374677 1:16024770-16024792 GTGGCTGTACAGGGAGATTGGGG + Exonic
902379624 1:16046542-16046564 GTGGCTGTACAGGGAGATTGGGG + Exonic
903377836 1:22877525-22877547 AAGGCTGCCGAGGAAGGTGGGGG - Intronic
903534770 1:24059753-24059775 GTGGGTGGCCAGGAAGAGTGTGG + Intronic
903909111 1:26709336-26709358 GTGGATGCACAGGAGGAAGGTGG - Intronic
904467048 1:30714370-30714392 GTGGCTGCCCAGGAGGAGGGAGG + Intronic
904607831 1:31707820-31707842 GTGGCTGGACAGGAAGACAGAGG - Intergenic
904659934 1:32076800-32076822 GCGGCGGCCCAGAACGATGGTGG - Exonic
905886974 1:41496718-41496740 AGGGCTGCCCAGGAGGAGGGGGG + Intergenic
906652171 1:47520709-47520731 GTGGCTGTCCAAGAAGCTGGAGG - Intergenic
906964615 1:50444182-50444204 GTTTCTCCCCAGCAAGATGGTGG + Intronic
908501190 1:64745157-64745179 CTGGGCGCCCGGGAAGATGGCGG + Exonic
911041422 1:93593893-93593915 GTGTCTGCCCAGTGAGAAGGAGG - Intronic
911797198 1:102090206-102090228 GTGCTTACCCAGGAACATGGAGG - Intergenic
912471496 1:109910273-109910295 GGGGCTGCAGAGGAAGAAGGGGG + Intronic
913144779 1:115977821-115977843 GTGGCTCAACAGGAAGATGGGGG + Intronic
913383413 1:118233611-118233633 GTGGCTGCTATGGGAGATGGGGG - Intergenic
914195907 1:145448073-145448095 GTGGTTGCCCAGGAAGCTCAGGG + Intergenic
914346062 1:146799450-146799472 GTGGCTGCTGTGGAGGATGGGGG - Intergenic
914664683 1:149823265-149823287 GGGGCAGGACAGGAAGATGGTGG - Intergenic
914671082 1:149870553-149870575 GGGGCAGGACAGGAAGATGGTGG + Intronic
915732690 1:158065480-158065502 GTGCCTGCCCAGGAAAAGGCAGG + Intronic
916012445 1:160718346-160718368 GAGGCTACCGAGGAAGAGGGAGG - Intergenic
916711284 1:167412009-167412031 GTGACTGCTGAGGAAGCTGGAGG - Exonic
916728312 1:167543557-167543579 GTGGTTCTCCAAGAAGATGGGGG + Intronic
918194820 1:182211457-182211479 GTGTTTGCCCAGGAAGAAGAGGG - Intergenic
919754695 1:201059374-201059396 GGGGCTTCCCAGGAAGAGGCAGG - Intronic
920518214 1:206602350-206602372 GTGGCTGCCAAGGAAAGTGCTGG + Exonic
922537289 1:226390594-226390616 GCGCCTGTCCAAGAAGATGGTGG - Exonic
922620758 1:226986614-226986636 CTCCCTGCACAGGAAGATGGGGG + Exonic
924003694 1:239583037-239583059 TTGGGTGACAAGGAAGATGGTGG - Intronic
924385725 1:243496653-243496675 GTGGCAGCCCGGGGAGATGGTGG - Intronic
1063371491 10:5525545-5525567 GTGGGCGCCCAGGAGCATGGTGG - Exonic
1063920028 10:10923277-10923299 GTGGCTGGGAAGGAAGACGGTGG + Intergenic
1064420766 10:15188840-15188862 GGGTCTGCCCATGAAGATGGTGG + Intergenic
1067944086 10:50679561-50679583 ATGGCTGCCCAGGTGGTTGGGGG + Intergenic
1070479781 10:76870748-76870770 GTGGCTGCCATGGTGGATGGAGG - Intronic
1070559248 10:77553493-77553515 GTGACTGCCCAGCAGGAGGGAGG - Intronic
1070724220 10:78777463-78777485 ATGGGTGCCCAGGCACATGGAGG + Intergenic
1070865580 10:79706431-79706453 ATGGCTGCCCAGGTGGTTGGGGG + Exonic
1070879373 10:79844562-79844584 ATGGCTGCCCAGGTGGTTGGGGG + Exonic
1071385193 10:85112734-85112756 GTTGGGGCCCAGGAAGTTGGGGG - Intergenic
1071564533 10:86664985-86665007 GAGGTTCCCCAGGAAGATAGAGG + Intronic
1071632481 10:87228652-87228674 ATGGCTGCCCAGGTGGTTGGGGG + Exonic
1071645930 10:87360870-87360892 ATGGCTGCCCAGGTGGTTGGGGG + Exonic
1072356250 10:94614542-94614564 GTGGCTGCTCCTGAAGCTGGAGG - Intergenic
1073094790 10:100972897-100972919 GGGCCTCCCCAGGAAGATGTGGG + Exonic
1075438044 10:122459776-122459798 CTGGCTGCTCAGGGGGATGGAGG + Intergenic
1076113931 10:127882205-127882227 GTGGCTGCCCATTAAATTGGGGG + Intronic
1077110733 11:860927-860949 GTGGGTGCCCAGGTGGGTGGTGG - Intronic
1077119400 11:899853-899875 CTGCCTTCCCTGGAAGATGGGGG + Intronic
1077755263 11:5021842-5021864 CTGTCTGCCCAGGAACATTGAGG - Intergenic
1078763536 11:14271880-14271902 CTGGATGACCAGGAAGGTGGTGG - Intergenic
1080595899 11:33774246-33774268 GTGGCTCCGCAGGATGAGGGCGG + Intronic
1080742361 11:35078471-35078493 GGGGCTGCCCAAGAAGAGGATGG - Intergenic
1081575993 11:44318889-44318911 GTCGGTGCGCAGGGAGATGGAGG + Intergenic
1083155732 11:60821819-60821841 TTGGCTGCCAAGGAAGGAGGTGG + Intergenic
1083385883 11:62310059-62310081 CAGGCTGCACAGGAAGCTGGTGG + Intergenic
1083698541 11:64458547-64458569 GTGGCTGCCGGGGACGAAGGGGG - Intergenic
1083842438 11:65312268-65312290 GTTGCTGCCTTTGAAGATGGAGG - Intergenic
1084618199 11:70250684-70250706 CTGGCTGCTCAGTAGGATGGAGG + Intergenic
1084776332 11:71379252-71379274 CTGGCTGCTCAGGAACATAGAGG - Intergenic
1086547637 11:88016586-88016608 GTGGCATCTCAGGAAGGTGGAGG - Intergenic
1087141140 11:94767516-94767538 GTTGCTGCCCAGGATGTTAGTGG - Intronic
1087211528 11:95450084-95450106 CTGGATGCCCAAGAAGCTGGTGG - Intergenic
1087383288 11:97436605-97436627 GTGGAAGCCCAGCAAGATGGAGG + Intergenic
1088504741 11:110516779-110516801 GTGGTGGCCAAGGAAGCTGGAGG - Intergenic
1088812173 11:113399329-113399351 GTGGATGCCCAGGAACGTGAAGG + Exonic
1088994462 11:114984647-114984669 ATCTCTGCACAGGAAGATGGAGG - Intergenic
1089618096 11:119706459-119706481 CTGGTTGCCTAGGAAGAGGGAGG + Intronic
1090095151 11:123735462-123735484 TTGGCAGCCTAGGAAGATGAAGG + Intronic
1091452334 12:580761-580783 GTGGCTGCCGTGGCATATGGAGG - Intronic
1091842477 12:3630889-3630911 GTGGGAGACCAGGAAGTTGGAGG + Intronic
1092478976 12:8843231-8843253 GTGGATGCCAAGGAAGCTGCGGG - Exonic
1096113353 12:49041383-49041405 GGGGCTGCCAATGAAAATGGTGG + Exonic
1096837977 12:54363294-54363316 GTAGATGCCCATGAGGATGGTGG + Exonic
1098498065 12:71159998-71160020 GAGGCTGCCTAGGAAGAAAGGGG - Intronic
1098500595 12:71187511-71187533 GTGGCTGCTGTGGGAGATGGGGG - Intronic
1099122742 12:78712089-78712111 CTCGCTGCCCAGAATGATGGTGG - Intergenic
1099365242 12:81759367-81759389 GTGGCTGCCAAGGAGGAGGAGGG - Intronic
1101248871 12:102911701-102911723 GTGGGTGGGGAGGAAGATGGGGG - Intronic
1102055031 12:109890110-109890132 GAGGCTGCCCCTGTAGATGGAGG - Intergenic
1102240684 12:111322717-111322739 ATGGCTGCACTGGAACATGGCGG + Intronic
1103008513 12:117439887-117439909 GCGTCTGCCCAGGAGGAGGGTGG + Intronic
1103258119 12:119560966-119560988 GTGGATACCCAGGAAGCTGGAGG - Intergenic
1103942600 12:124509138-124509160 GTGGTTGCCCAGGGAAATTGGGG - Intronic
1104166838 12:126239893-126239915 GTGGCTGGCTTTGAAGATGGAGG - Intergenic
1104630916 12:130401482-130401504 GTTGCTGAACAGGAAGATGCAGG - Intronic
1104663710 12:130632517-130632539 CCGGCAGCCCAGGAAGATGAGGG - Intronic
1105417146 13:20223347-20223369 GTGGCTGCCCAGGAAGTGTGGGG - Exonic
1105818113 13:24055411-24055433 CTGTCTGCCTAGGGAGATGGAGG + Intronic
1106312022 13:28562952-28562974 GTGGCTGCCCATGATGGTGGGGG + Intergenic
1106432336 13:29693099-29693121 GTGGGAGTCCAGGAAGAAGGTGG - Intergenic
1106454724 13:29917129-29917151 GTGGCTGGCTTTGAAGATGGAGG + Intergenic
1106940183 13:34769595-34769617 GTAGCTGCCAGGAAAGATGGTGG - Intergenic
1107393585 13:39992871-39992893 CTGGCAGCCCAGGAATAAGGTGG + Intergenic
1108131901 13:47310557-47310579 GTGGCTGCTATGGGAGATGGGGG - Intergenic
1109246634 13:59962515-59962537 GGGGCTGCCCAGGAGGAGTGTGG - Intronic
1110748085 13:79079549-79079571 GTGGCTGCTCTGGCAGATGCGGG - Intergenic
1111940102 13:94599226-94599248 CTGGCTGACCAGGAATATGCTGG - Intergenic
1112130437 13:96517438-96517460 TAGGCTTCCCAGGGAGATGGGGG + Intronic
1112844661 13:103625338-103625360 GTGGCTGCCCAGTGAGAGGCTGG - Intergenic
1113240254 13:108328946-108328968 GTGGCTGCTCTGGGGGATGGGGG - Intergenic
1114558936 14:23577621-23577643 GTGGCTGCGGAGAAAGAGGGAGG + Exonic
1114773816 14:25458457-25458479 GAGGCTGCCCAGGAAGAGCAAGG - Intergenic
1117224950 14:53647036-53647058 CTGGCTGCTGGGGAAGATGGTGG + Intergenic
1118730063 14:68659701-68659723 GTCGCTTCCCAGGCAGAGGGAGG - Intronic
1119072048 14:71596327-71596349 GGGGCTGCCCAGGAGGAGTGTGG + Intronic
1119188438 14:72661657-72661679 GTGGGAGCCAAGGAAGACGGCGG - Exonic
1119642667 14:76326906-76326928 GTGGCTGCTCTAGCAGATGGTGG - Intronic
1119737877 14:76995527-76995549 GGGGCTTCCCAGGCAGTTGGGGG - Intergenic
1120195045 14:81472112-81472134 GTTGCAGCCAATGAAGATGGAGG + Exonic
1120833167 14:89016121-89016143 GAGGGTGACTAGGAAGATGGAGG + Intergenic
1121404926 14:93713935-93713957 CTGGGAGCCCTGGAAGATGGTGG + Intergenic
1121553188 14:94817927-94817949 GCAGCTGCCCTGGCAGATGGAGG + Intergenic
1122034334 14:98936457-98936479 GTGGCTGGCTTTGAAGATGGGGG + Intergenic
1122723803 14:103737238-103737260 CTGGCTGCCCCTGAAGAAGGTGG + Intronic
1122868915 14:104625127-104625149 GAGGCTGCCCAGGAAGAACAAGG + Intergenic
1124047560 15:26164141-26164163 GTGGGTGGCAAGGAAGGTGGTGG + Intergenic
1125071665 15:35562009-35562031 GTTGCTGCCTTGGAAGATGGAGG + Intergenic
1125275334 15:37983455-37983477 ATGGCTGGCCAGGGAGATGTTGG + Intergenic
1127935739 15:63635987-63636009 GCGGCGGCCCAGGCAGATCGAGG - Exonic
1128818364 15:70630378-70630400 CTGGCAGCCCAGGACAATGGAGG + Intergenic
1129187888 15:73921633-73921655 GTGGGTGCCCAGGCTGGTGGGGG - Intergenic
1131057574 15:89384659-89384681 GTGGCTGCTCGGGATGATGCTGG + Intergenic
1131057662 15:89385201-89385223 GTGACAGACCAGCAAGATGGGGG - Intergenic
1131387911 15:92022822-92022844 GAGGCTTCCCAGGAAGAAGAAGG + Intronic
1131401094 15:92126196-92126218 GTCGCAGCCCAGGAAGAGGAAGG - Exonic
1131778591 15:95829231-95829253 ATGGCGGCTCAGGAAGAGGGAGG - Intergenic
1132627677 16:899489-899511 GTGGCTGCCCAGGACCAGGGCGG + Intronic
1132678485 16:1130370-1130392 GAGGCTGCCCAGGAGGCTGGGGG + Intergenic
1132713499 16:1279424-1279446 CTGGCTGCCCTGGAATTTGGCGG - Intergenic
1133129223 16:3665902-3665924 GGGGCTGCTGAGGAAGCTGGTGG - Intronic
1133321945 16:4919549-4919571 GTGGCTGGCCAGGCATATTGTGG - Intronic
1134091979 16:11396411-11396433 GGGGCCGCCCAGGCAGTTGGGGG + Intronic
1134742228 16:16558117-16558139 GTTACTGCCCTTGAAGATGGAGG + Intergenic
1134907362 16:17991791-17991813 GTGGTTGCTAAGGAAGATGGAGG + Intergenic
1134925336 16:18154339-18154361 GTTACTGCCCTTGAAGATGGAGG - Intergenic
1135398038 16:22146256-22146278 GTGGACGCCCAGGGAGATGGAGG + Exonic
1135401476 16:22169264-22169286 CTGGCCACCCAGGAAGATGGTGG + Intronic
1135755009 16:25089926-25089948 GTGGCTGGCCATGAAGCTGGAGG + Intergenic
1135928639 16:26717630-26717652 GTGACTTGCCACGAAGATGGTGG + Intergenic
1136374866 16:29859378-29859400 TGGCCTGCCCAGGGAGATGGAGG - Intronic
1136493218 16:30624562-30624584 GGGGCTGCCCAGGAAGAGGAGGG + Intergenic
1137350812 16:47712688-47712710 GTGGGTGTCCAGGCAGTTGGCGG - Intergenic
1137576706 16:49604801-49604823 GTGGCAGCCCAGGAATGGGGTGG - Intronic
1137610622 16:49814863-49814885 GTGGATGGCCAGCAAGACGGAGG + Intronic
1138533286 16:57646512-57646534 GCGGCTGCTCTGGAAGCTGGGGG + Intronic
1139295501 16:65897030-65897052 GTGGGTGCCCCGGAAGCTGTGGG - Intergenic
1139987917 16:70915817-70915839 GTGGCTGCTGTGGAGGATGGGGG + Intronic
1140310346 16:73842349-73842371 GTGCCTCCCCAGGATCATGGTGG + Intergenic
1140856580 16:78983272-78983294 GTGTCTGGCCAAGAAGCTGGCGG + Intronic
1141626877 16:85266107-85266129 GAGGCTCCCCAGGGAGGTGGGGG + Intergenic
1141945171 16:87304693-87304715 GTGACTGCCCAGGGAGTGGGAGG + Intronic
1142128597 16:88422164-88422186 GTGGATGGGCAGGAGGATGGGGG + Intergenic
1142231500 16:88902213-88902235 GTGTCTGCCCAGGGAGAGGCCGG + Intronic
1142368088 16:89661006-89661028 GTGGTTGTCCAGGCAGTTGGAGG - Intronic
1142401174 16:89859434-89859456 CTGCCTGCTCAGGAAGATGTGGG - Intronic
1143185485 17:5007492-5007514 GTGGCCGTCCGGGAGGATGGGGG + Exonic
1143558550 17:7677557-7677579 TTGGCTAGCCAGGAACATGGGGG + Intronic
1143880087 17:10023233-10023255 GTGGCTGCCTCGGGAGATGGAGG - Intronic
1144057318 17:11554692-11554714 GTGGCTGCCATGGGAAATGGTGG - Intronic
1144829100 17:18121757-18121779 GTGTCTGCCCAGGAAGACCCTGG - Exonic
1145827275 17:27886547-27886569 TTGGTTGCCTGGGAAGATGGAGG - Intronic
1145884209 17:28371521-28371543 GGGGCTGCGCAGGAGGCTGGAGG + Intronic
1147156210 17:38545594-38545616 GAGGCTACCCAGTAAGTTGGAGG + Intronic
1147729179 17:42586939-42586961 CTGCCTGCACAGCAAGATGGGGG - Intronic
1148045086 17:44738542-44738564 GTGGCTTCTCAGGAAGATGAAGG - Intronic
1148065058 17:44862967-44862989 CTTGCTGTCAAGGAAGATGGCGG - Intronic
1148325609 17:46781898-46781920 CTGGCTGCCCAGGAGGTGGGAGG + Intronic
1148748408 17:49931144-49931166 GTGCCAGCCCAGGATGATGATGG - Intergenic
1148763693 17:50023142-50023164 CTTGGTTCCCAGGAAGATGGTGG + Intergenic
1148780243 17:50117432-50117454 GTGGCGGCGCACGAAGCTGGGGG + Exonic
1150150605 17:62806110-62806132 GTGTCAGACCAAGAAGATGGTGG + Intronic
1151826832 17:76528475-76528497 CTGGGTGCCAAGGAAGCTGGAGG - Exonic
1151845118 17:76648231-76648253 GTCGCTTCCCAAGAAGATGGGGG - Intergenic
1151877689 17:76876571-76876593 GTGGCTGCGAAGGGAGAGGGAGG + Intronic
1152070906 17:78133164-78133186 ATGGCTTCCCAGGATGAGGGTGG - Intronic
1152251422 17:79214600-79214622 GTGGCTGTCCAGGGAGAGAGAGG + Intronic
1152408382 17:80110117-80110139 GCAGCTGCTCAGGAAGACGGTGG + Intergenic
1152755552 17:82085585-82085607 GTGGCTGCCCTGAGAGAAGGGGG - Exonic
1152876018 17:82786591-82786613 GTGGCTGCCCAGGGACTTGCAGG + Intronic
1153128618 18:1828121-1828143 GTGGCTGCCAGAGATGATGGGGG - Intergenic
1153212945 18:2788026-2788048 CTGGCTGACCTGGAAGGTGGTGG - Intronic
1154388282 18:13914916-13914938 GTTGCTGCCTAGGAAGGTGGAGG + Intronic
1155184642 18:23376586-23376608 GGGGCTGCCCAGGAACAGGCAGG + Intronic
1156353393 18:36321204-36321226 GTGTCTGCCCAGGTGCATGGTGG + Intronic
1157179818 18:45487231-45487253 GTTGCTGCCTTTGAAGATGGAGG - Intronic
1157803375 18:50639034-50639056 GTAGGTGACCAGGCAGATGGGGG + Intronic
1159891364 18:73956104-73956126 GTGGCTGGCATTGAAGATGGGGG - Intergenic
1160784512 19:893156-893178 GTTGTTACCGAGGAAGATGGCGG - Exonic
1160828295 19:1090830-1090852 GTGGGTGGCCAGGAAGATGTGGG - Intronic
1160841098 19:1147384-1147406 CTGGCTGCCGAGGAAGGAGGCGG + Exonic
1160864878 19:1252110-1252132 GTGGCTGCCCTGGGGGAAGGGGG + Intronic
1161457437 19:4376616-4376638 GGGGCCGCCCAGGCAGATGGGGG - Intronic
1163007450 19:14405899-14405921 GATGCCGGCCAGGAAGATGGTGG - Exonic
1163133088 19:15288743-15288765 GTGCCTGCCCCTGCAGATGGAGG + Intronic
1163153622 19:15428594-15428616 TTGGCTGCTCAGGCAGTTGGGGG + Intronic
1163352731 19:16788644-16788666 GTGGCTGGACAGGAAGTTGCTGG + Intronic
1163534770 19:17870884-17870906 GTGATTGCCCAGAAAGTTGGAGG + Intergenic
1163660275 19:18572894-18572916 CTGGCTGCCGTGGAAGAGGGTGG + Intronic
1163784893 19:19269953-19269975 GTGGCTGCCCAGGCACAGGGTGG + Intronic
1164415066 19:28040040-28040062 GTGGCTGCCCTGGGACAGGGAGG + Intergenic
1164732403 19:30516277-30516299 GAAGCTGCCCAGGAGGACGGAGG - Intronic
1165287485 19:34853801-34853823 GTGGCCACCCAGGAAGGTGTGGG + Intergenic
1165475189 19:36026397-36026419 GGGGCTGCCAAGGGAGAGGGGGG - Intronic
1166441874 19:42822755-42822777 GTGGCTGCTCAGGAGGACTGTGG + Intronic
1166461305 19:42991040-42991062 GTGGCTGCTCAGGACAGTGGAGG + Intronic
1166601754 19:44101863-44101885 GTTGCTGCCTTTGAAGATGGAGG - Intronic
1166603572 19:44119502-44119524 GTAGCTGCCTTTGAAGATGGAGG - Intronic
1167111707 19:47466336-47466358 GTGGCTGCCCCGGAGCATGGGGG + Exonic
1167254624 19:48419720-48419742 GTAGCTGGCGAGGAAGATGACGG - Exonic
1167520293 19:49950791-49950813 GTGGATGCCCAGGAAGGAGGAGG + Intronic
1167751082 19:51380575-51380597 GCGGCGGCCCAGGAAGCTGACGG + Exonic
1168353021 19:55687284-55687306 GTGGCTGGGGAGGAGGATGGGGG + Intronic
1168558312 19:57362233-57362255 CTTGCTGCCCAGGAGGATGGTGG - Intergenic
924985139 2:264015-264037 GAGGCTGCCCAGGAAGAGGAAGG + Exonic
925029675 2:639969-639991 GTGACTGCCAGGGAAGCTGGAGG + Intergenic
925668056 2:6282550-6282572 GTCGCTGTGCAGGAAGATGGTGG + Intergenic
926616203 2:14999094-14999116 GTGGCAGACCAGAAAGAAGGGGG + Intergenic
926695324 2:15766729-15766751 GTGGCTGCCCACCTGGATGGAGG + Intergenic
927242955 2:20934751-20934773 CTGGGTCCCCAAGAAGATGGAGG - Intergenic
929535776 2:42783480-42783502 GGGGATGCCCAGGATGTTGGGGG - Intronic
931779531 2:65567259-65567281 GTGGTTGCCCAGGAATAGTGAGG + Intergenic
931993015 2:67809780-67809802 GTGGCTGCTGTGGCAGATGGGGG - Intergenic
932954642 2:76337318-76337340 GTGGCTGCCATGGGGGATGGTGG + Intergenic
933763084 2:85687480-85687502 CTGGGTGGCCAGGGAGATGGTGG - Intronic
934521120 2:95020804-95020826 GTGGATGTGCAGGAAGAGGGAGG - Intergenic
935746092 2:106191601-106191623 GAGGCTGCCCAGGCAGACAGGGG - Intronic
936281282 2:111142074-111142096 GTGTCTGCCCTGGAAAGTGGGGG + Intronic
936518251 2:113196041-113196063 GTGGCTTCCCAGGAAAAGAGAGG + Intronic
936625180 2:114141098-114141120 GAGACTGCCCAGGAAGAAGAGGG - Intergenic
936783636 2:116065800-116065822 CAGGCTGCCCTTGAAGATGGAGG - Intergenic
936971853 2:118184048-118184070 GTGGCTTCCCTGGAAGATTCTGG + Intergenic
937521781 2:122720949-122720971 GTGGCTGCTGTGGAGGATGGGGG - Intergenic
938163784 2:129009145-129009167 GAGGATGCCCAGGAAGGTGCAGG + Intergenic
940214227 2:151288376-151288398 GTTGCTGGCCCTGAAGATGGAGG + Intronic
940323240 2:152399298-152399320 GTGGCAGCACAGGATGAGGGAGG + Intronic
940569760 2:155416741-155416763 GCCCCTGCCCAGGCAGATGGTGG + Intergenic
941593849 2:167451859-167451881 GTGGCTGCTGTGGAGGATGGCGG + Intergenic
941844378 2:170118809-170118831 GAGGCTGCCTTGGAAGATGTGGG + Intergenic
942691744 2:178592447-178592469 AATGCTGCCCATGAAGATGGTGG - Exonic
942978111 2:182043796-182043818 GAGAATGCCCAGGAAGACGGTGG - Intronic
943802483 2:192079122-192079144 GTGGCTGCCCAAGAACAATGTGG - Intronic
943922740 2:193730011-193730033 TTGGCTGCCCAGGATGATAGAGG - Intergenic
944414772 2:199470273-199470295 GAGGATCCCCAGGAAGATGCTGG + Intronic
944676349 2:202036092-202036114 GTAGCAGGCCAGGACGATGGTGG - Exonic
946136298 2:217650360-217650382 CTGTGTGCCCAGGAAGATGTGGG - Intronic
946496902 2:220204122-220204144 GTAACTGCCCAGGAAGCTGGAGG + Intergenic
947511685 2:230760642-230760664 GTGTCCTCCCAGGAAGATTGTGG - Intronic
947528392 2:230893449-230893471 GTGGCTGCCCAGGCTGAGGCTGG - Intergenic
948051370 2:234981945-234981967 GTGGCCACCCAGGAAGGAGGCGG - Intronic
948304289 2:236935246-236935268 GAGGCTGCAGGGGAAGATGGTGG + Intergenic
948595627 2:239077433-239077455 GTGCCTGCCCTGGAGGATAGCGG - Intronic
1169009257 20:2236687-2236709 CTGGCTGCGCAGGGAGATGGGGG + Intergenic
1169197719 20:3692477-3692499 AGGGCTGCCCAGGAGGAGGGTGG - Intronic
1169433049 20:5556699-5556721 GTGGCTGCCAAAGAAGCTGATGG + Intronic
1170686525 20:18574647-18574669 GTGGCTGCCAGGCAAGATGGCGG - Intronic
1170826483 20:19800555-19800577 CTGGCTTCCCAGAAACATGGTGG - Intergenic
1171166411 20:22975729-22975751 CTGGCTGCTCAGGAGTATGGGGG - Intergenic
1171781019 20:29417810-29417832 GAGGCTGCCCCGGAATATGGTGG - Intergenic
1171895873 20:30760507-30760529 GTGGTTGCCTATGAACATGGGGG + Intergenic
1172006972 20:31824373-31824395 GTGGCTGCCCAGGATGGGGAGGG + Intronic
1172354998 20:34273531-34273553 GTGGTTGCTCAAAAAGATGGAGG - Intergenic
1172462663 20:35131856-35131878 CTGACTGCCCAGGGAGATGCAGG + Intronic
1172812837 20:37662046-37662068 GTTGCTGGCCTTGAAGATGGAGG - Intergenic
1172891379 20:38268307-38268329 CAGGCTGCCCAGGAAGCAGGTGG - Intronic
1174132272 20:48354131-48354153 GTGGGTGCTCAGAGAGATGGTGG + Intergenic
1174500523 20:50980949-50980971 GAGGCAGCCCAGGCAGGTGGAGG + Intergenic
1175057207 20:56209112-56209134 GTGGCTGGCTAGGCAGAAGGTGG - Intergenic
1175851792 20:62097696-62097718 GAGGGTTCCCAGGAAGAGGGTGG + Intergenic
1179436273 21:41364188-41364210 GTGAAGGCCCAGGAAGCTGGTGG - Intronic
1179476247 21:41648107-41648129 CTGCCTTCCCAGGCAGATGGGGG + Intergenic
1179724017 21:43331697-43331719 GAGGCGGGGCAGGAAGATGGAGG - Intergenic
1179921838 21:44511818-44511840 GTAGCAGCCCAGGGTGATGGGGG + Intronic
1179957414 21:44749340-44749362 GCGGCTGCCCAGGCAGGTCGGGG + Intergenic
1180143062 21:45904355-45904377 GTGGATGCTCAGGAAGCTCGAGG + Intronic
1180143071 21:45904424-45904446 GTGGATGCTCAGGAAGCTCGAGG + Intronic
1180990497 22:19932888-19932910 TTGCCTGCCTAGGAAGGTGGAGG - Intronic
1181627875 22:24133691-24133713 GTGGCTGGCCAGGCAGCTGGTGG + Intronic
1181838244 22:25628982-25629004 GTGACTGGGCAGGAAGATGAAGG + Intronic
1181857915 22:25795696-25795718 GTGGCGGCCCAGAAATATGATGG + Intronic
1181978384 22:26748936-26748958 CTAGCTGCCCAGGGAGAGGGAGG - Intergenic
1183123527 22:35751912-35751934 GTGGCTACCCAGCAAGATTTTGG - Intronic
1183163582 22:36131220-36131242 GTGACAGACCAGGAGGATGGGGG - Intergenic
1183175757 22:36223677-36223699 GTGTCTGCCCACCAAGTTGGTGG - Intergenic
1183363373 22:37394482-37394504 GAGGCTGCCCGGGAGGAGGGCGG - Intronic
1183471535 22:38009682-38009704 GTGGTTGCCTAGGGAGAGGGTGG - Intronic
1183502353 22:38188557-38188579 GTGGGTGCCCTGGAAGGTTGGGG + Intronic
1183689153 22:39378523-39378545 GTTCCTGCCCAGGCAGCTGGGGG - Intronic
1183735639 22:39643419-39643441 GGGGCTGGCCAGGAAGAGGAGGG - Intronic
1184031517 22:41897702-41897724 GTGGCCACCCTGGAAGATGGGGG + Intronic
1184443646 22:44534542-44534564 ATGACTGCCCAGGAATTTGGAGG - Intergenic
1184548588 22:45191047-45191069 AAGGCAGCCCATGAAGATGGAGG - Intronic
949478708 3:4472848-4472870 GGAGCTGCCCAGGAAGAGCGTGG + Intergenic
950014656 3:9747169-9747191 GTGGCTGCCCAGGACCAAGCTGG + Exonic
950458421 3:13106255-13106277 GTGGGAGCCCAGGAAGGTGCTGG - Intergenic
950673398 3:14540333-14540355 GTGGCTCCCGAGGGAGTTGGTGG - Exonic
951750084 3:26025344-26025366 GTGGCTGTCGTGGAGGATGGGGG + Intergenic
953186830 3:40645918-40645940 GTGTCTGCCAAGGAAGATGGAGG + Intergenic
953686126 3:45079686-45079708 GTGGCTGCCGAGGAGTCTGGTGG - Intergenic
954238021 3:49271960-49271982 GTGAAAGCCAAGGAAGATGGTGG + Intronic
956046248 3:65199247-65199269 GTTGATGACCAGGGAGATGGAGG + Intergenic
957083976 3:75663475-75663497 GAGGCTGCCCTGGAATATGGTGG + Intergenic
957575426 3:82001398-82001420 GTGACTTCCAAGGAGGATGGGGG - Intergenic
958790540 3:98645871-98645893 TTGGCAGACAAGGAAGATGGTGG - Intergenic
959361744 3:105402705-105402727 GTGGCTGCCATGGGGGATGGGGG - Intronic
959405560 3:105958463-105958485 GAGGATGCACAGCAAGATGGTGG - Intergenic
961724968 3:128921891-128921913 GTGGCTCCCCAGGAAGGAGATGG - Intronic
962069424 3:132017819-132017841 TGGGCTGCCCAGGAAGCCGGTGG - Intronic
963695051 3:148556127-148556149 TTGGCTGCCCTGTAAGATAGAGG - Intergenic
964219746 3:154329597-154329619 GTTGCTGGCCTTGAAGATGGAGG + Intergenic
967882791 3:194313773-194313795 GGGGCTGGCCAAGAAGATTGGGG - Intergenic
968480289 4:830218-830240 GTGGCTCCCCCTGAAGCTGGAGG - Intergenic
968502626 4:958123-958145 GATGCTGGCCAGGAAGATGATGG - Exonic
968610492 4:1554686-1554708 GTGGCTGCACAGGCAGAAGGCGG - Intergenic
968649586 4:1755196-1755218 GTGGCTTCCCTGAAAGCTGGTGG - Intergenic
968664876 4:1815560-1815582 GTAGCTGCCCAGGAGGGTGCCGG + Intronic
968693534 4:2008905-2008927 GTGGCTGCACAACAAGCTGGGGG - Exonic
968726710 4:2251291-2251313 GTGCCTGGCCAGGGGGATGGGGG - Intronic
969455146 4:7296193-7296215 ATGGGTGTCCAGGAAGATGGGGG - Intronic
969496777 4:7530764-7530786 TTGGCTGCCCAGCAAGAAGAGGG - Intronic
969758911 4:9168547-9168569 GGGCCTGCCCATGAAGGTGGTGG - Intergenic
970312064 4:14793123-14793145 GTGGCTGCTGTGGAGGATGGGGG - Intergenic
975354486 4:73385328-73385350 GCGGCTGCCCAACAAGATGGAGG - Intergenic
975769766 4:77708526-77708548 GTGGGGGCACAGGAAGAGGGAGG - Intergenic
976138933 4:81970204-81970226 ATGGCTACCCAGAAAGAAGGTGG + Intronic
978317191 4:107451392-107451414 TTGGCTGCACAGGAAGATTTGGG + Intergenic
978591989 4:110333996-110334018 GAGGCTGGACAGGAAGGTGGAGG + Intergenic
979284423 4:118905678-118905700 GTGGCTGGCCAGGGAAAGGGAGG - Intronic
982960322 4:161827626-161827648 GTGGCTGCTGTGGAAGATGGGGG + Intronic
983650209 4:170029463-170029485 GTGGTTGATCAGGAAGATGATGG - Intronic
984551305 4:181162827-181162849 GAGGCTGCAGAGGAAGCTGGGGG - Intergenic
985424446 4:189815065-189815087 GTTGCTTCCCAGGAAGATGATGG - Intergenic
985663160 5:1167409-1167431 AGGGCTGGCCAGGAAGCTGGAGG - Intergenic
987030409 5:13971995-13972017 GTGGCTGCTGTGGAGGATGGGGG + Intergenic
988960053 5:36360747-36360769 GTGGCTTCACAAGAATATGGGGG + Intergenic
989108975 5:37889074-37889096 GTGGCTGCCTCTGGAGATGGAGG + Intergenic
989171105 5:38470724-38470746 GTGGGTGCCCAGGGGGATTGAGG + Intergenic
989277757 5:39609665-39609687 GTTGCTGCCCTGGATGAGGGTGG + Intergenic
990793909 5:59518455-59518477 GTGGCTGCCCAGGAGGAGGGGGG + Intronic
992118738 5:73568522-73568544 GTGGCTGGCAGTGAAGATGGTGG + Exonic
995017864 5:107332125-107332147 GTGGCAGCTCAGGAATAAGGAGG + Intergenic
996755192 5:126927658-126927680 TTGGCTTCCCAGGAGGATTGTGG - Intronic
996777366 5:127147186-127147208 GTAGTTGCCCAGGGAGATGTTGG - Intergenic
997346079 5:133193129-133193151 GTGCCTGCCAGGGCAGATGGTGG + Intergenic
997588809 5:135060674-135060696 GTGGCTGGCTTTGAAGATGGAGG - Intronic
997664627 5:135620184-135620206 GTGGCTGCCCACTATGTTGGTGG + Intergenic
997727927 5:136137638-136137660 GTGTGTTCCCAGGAAGAGGGGGG + Intronic
998205533 5:140154503-140154525 GTGGCTGCCTGGGAAGAAGCTGG - Intergenic
999319976 5:150608352-150608374 CTGGCCAGCCAGGAAGATGGAGG - Intronic
1000383167 5:160647263-160647285 GGGTCTGCTCAGGAAGAAGGTGG + Intronic
1001177149 5:169480937-169480959 GTGGCTGCTGTGGGAGATGGGGG + Intergenic
1002027413 5:176404849-176404871 GAGGCTGCCCAGGGGGATGTGGG - Intronic
1002440375 5:179261511-179261533 GTTGCTGACCCGGCAGATGGCGG - Intronic
1002830683 6:817645-817667 GTGGCTGCCAAGGACTAGGGAGG - Intergenic
1003247730 6:4398477-4398499 GTGGCTGGGCAGGAAGAAGCTGG + Intergenic
1003264251 6:4551619-4551641 GTGACAGCCCAGGAAGAGGAAGG - Intergenic
1004291727 6:14373770-14373792 GGGGCTACCCAGGAAGATCTGGG - Intergenic
1005187717 6:23181516-23181538 GTGGCGCTCCAGGAAGAAGGAGG + Intergenic
1005927073 6:30452939-30452961 GAGGCTGCGCAGGCAGCTGGGGG - Intergenic
1005928148 6:30461945-30461967 GTTGCTTGCCAGGAAGCTGGTGG + Intergenic
1006419638 6:33925039-33925061 GTGGCTTCCCAGGAATCAGGTGG - Intergenic
1006513696 6:34534697-34534719 GTGGCTGCTCAGGACGGAGGGGG - Exonic
1006579791 6:35070282-35070304 GAGGCTTTCTAGGAAGATGGGGG - Intronic
1006741647 6:36313153-36313175 GTGGCTGTAGAGGAAGAAGGAGG + Intergenic
1007025492 6:38568326-38568348 TTGGATGACCAAGAAGATGGAGG - Intronic
1007284238 6:40736364-40736386 GGGCCTGCCCTGGGAGATGGGGG - Intergenic
1008441555 6:51537547-51537569 GTGGCAGTGCAGAAAGATGGAGG + Intergenic
1008528624 6:52433850-52433872 GTGGCTGCTGTGGAGGATGGGGG + Intronic
1009453172 6:63825219-63825241 GTGGCTGCTGTGGAGGATGGGGG - Intronic
1010235439 6:73571441-73571463 ATGCCTGCCCTGGCAGATGGAGG + Intergenic
1011136074 6:84102435-84102457 GTTGCTGGCTATGAAGATGGAGG + Intergenic
1011156629 6:84340824-84340846 GTGGCTGCTGTGGATGATGGGGG + Intergenic
1012352462 6:98269517-98269539 GTGGCTGCCTTTGAAGAAGGAGG + Intergenic
1012554581 6:100495971-100495993 GTAGCTGCACAGGAATATGAAGG - Intergenic
1013896533 6:115095316-115095338 GTGGCTGCCTAGGAAGCAGCTGG + Intergenic
1014431947 6:121381445-121381467 GTGGCAGTGCAGAAAGATGGCGG - Intergenic
1014478142 6:121900875-121900897 GTGACTGCACAGGAAGTTGTGGG + Intergenic
1015427436 6:133088186-133088208 GTGGCTGACTTGGAAGATGAAGG + Intergenic
1018391536 6:163345152-163345174 GGGGCAGCCCAGGAAGAGTGTGG + Intergenic
1018705677 6:166461823-166461845 ATGGGTCCCCAGGATGATGGAGG - Intronic
1018743705 6:166748601-166748623 GTGGGGGCCCAGGGAAATGGGGG - Intronic
1019123471 6:169824014-169824036 GTGGCTGCTGTGGAGGATGGGGG + Intergenic
1020495112 7:8841417-8841439 GTGGCTGCCCAGCAAGCTAGAGG + Intergenic
1022527672 7:31049014-31049036 ATGGCTGCCCAGGAGGCTGAGGG + Intergenic
1023316469 7:38942886-38942908 GAGGGGACCCAGGAAGATGGAGG + Intergenic
1024016624 7:45322316-45322338 GTGGCTGCCCATGAATATAGAGG - Intergenic
1024094019 7:45970131-45970153 GTGGCTGCCCAGGCAGGGGGTGG + Intergenic
1025854268 7:65264377-65264399 GGGGCTGCCGAGGATGCTGGGGG + Intergenic
1027164159 7:75822917-75822939 GTTCCTTCCCAGGAAGATGTAGG - Intronic
1027771550 7:82413441-82413463 GGGGCTCCCCAGGGAGATGTGGG - Intronic
1027831470 7:83182843-83182865 CTGGCTGTCCAGGCAGATGTTGG - Intergenic
1028200633 7:87956611-87956633 GTGGGTGCCCAGGCTGAGGGTGG - Intronic
1029550413 7:101234387-101234409 GAGGAAGCCCAGGAGGATGGCGG + Exonic
1032527699 7:132592214-132592236 GTAGCTGCAAAGGAAGATGAGGG - Intronic
1034413874 7:150955090-150955112 ATGGGTGCCCAGAGAGATGGTGG - Intronic
1034448131 7:151123688-151123710 AGGGCTGCCCAGGAGGAGGGAGG + Intronic
1034545652 7:151786924-151786946 GTGTCTGCCTAGGAAGATGATGG + Intronic
1034683200 7:152946998-152947020 GTGGCTGCTGTGGGAGATGGGGG + Intergenic
1035117999 7:156540917-156540939 GTGGCAGGCCAGGAAGCAGGTGG + Intergenic
1035273795 7:157735465-157735487 GCAGCGGCCCAGGAAGGTGGAGG + Intronic
1035414732 7:158673435-158673457 CTGGCTGCCCGGGAAGAAGAAGG - Intronic
1035989821 8:4477166-4477188 GTGTCTGCGCAGGAAGACAGTGG - Intronic
1036483403 8:9157713-9157735 GTGGCTGGTCAGGGAGAAGGTGG + Intronic
1036719180 8:11156892-11156914 CTTGCTTCCAAGGAAGATGGGGG + Intronic
1037290122 8:17341474-17341496 CTGGCTGCTCCGGCAGATGGAGG + Exonic
1039077427 8:33704419-33704441 GTGGCTGGCTTTGAAGATGGAGG + Intergenic
1039449281 8:37658755-37658777 GTGTCTGCAGAGGAAGATGTTGG - Intergenic
1040458404 8:47622592-47622614 CTGGCGTCCCAGGAGGATGGGGG + Intronic
1041877991 8:62712411-62712433 GTGGCTGCTGTGGAGGATGGGGG + Intronic
1044958527 8:97506352-97506374 AAGGGTGACCAGGAAGATGGAGG + Intergenic
1045245127 8:100435938-100435960 GTTGCTGGCTTGGAAGATGGAGG - Intergenic
1046774111 8:118145855-118145877 GGGGCTGCCCAAAAAGATCGTGG + Intergenic
1047198947 8:122747440-122747462 GTGGCTGGCTCTGAAGATGGAGG + Intergenic
1048003829 8:130402101-130402123 GTGGCTGTCCAGAAATATGAAGG + Intronic
1048070700 8:131017612-131017634 GTGGCTGCCCATGCAGAGTGTGG - Intronic
1049254709 8:141607659-141607681 GGGGCTGCCCAGTGAGAAGGAGG - Intergenic
1049402547 8:142436051-142436073 CTGTGTGCCCAGGAAGGTGGAGG - Intergenic
1049471052 8:142775182-142775204 GAGGGTGGCCAGGAGGATGGGGG + Intronic
1050293494 9:4180928-4180950 CAGGATGCCCAGGGAGATGGTGG - Intronic
1050343381 9:4662708-4662730 GTGGCTGTCCAAGAAGCTGGGGG + Exonic
1051191091 9:14514352-14514374 GTGCATGCCCAGAAAGGTGGTGG - Intergenic
1052894586 9:33735224-33735246 GTGGCTGCTGTGGGAGATGGAGG - Intergenic
1052894592 9:33735254-33735276 GTGGCTGCTGTGGGAGATGGAGG - Intergenic
1054352774 9:64032269-64032291 GTGGTTGCCTATGAACATGGGGG - Intergenic
1055795416 9:79970347-79970369 TTGGCTGCCCAGGAAGCATGTGG + Intergenic
1057211996 9:93205491-93205513 GGGGCTGACCAGCAGGATGGGGG - Intronic
1060144863 9:121243213-121243235 GTGGCTGGCCTTGAAGATGAAGG - Intronic
1060780000 9:126404523-126404545 GAAGCTGCACAGGAAGATGGCGG - Intronic
1061157851 9:128875836-128875858 GTAGCTGCCCAGGCTGATAGAGG - Intronic
1061483552 9:130908956-130908978 GTGACACCCCTGGAAGATGGGGG - Intronic
1062248587 9:135583135-135583157 GTGCCTGCCCTGGAGGCTGGCGG - Intergenic
1062428841 9:136518033-136518055 GGGGGTGCCCAGTTAGATGGGGG - Intronic
1062467570 9:136687812-136687834 GTGGCTGCCCCGGCAGCGGGGGG - Intergenic
1062474267 9:136719688-136719710 GTAGGTGCCCAGGACCATGGAGG + Intronic
1062698825 9:137888749-137888771 GTGGTTGCCCAGGAAGCTCAGGG - Intronic
1203741110 Un_GL000218v1:1368-1390 GTGGTTGCCTATGAACATGGGGG - Intergenic
1185667865 X:1781768-1781790 GTGGCTGTTCATGAAGATGATGG + Intergenic
1186057147 X:5661823-5661845 GAGGTTGTCCAGGCAGATGGTGG + Intergenic
1186134800 X:6507740-6507762 GAGGCTGCCAAGCAAGAAGGTGG - Intergenic
1189491486 X:41474424-41474446 GAGGCGGCCCAGGAAGAAGCCGG - Exonic
1189732077 X:44032046-44032068 GTGTCTGCCCACCAAAATGGTGG + Intergenic
1189879045 X:45470555-45470577 GTGGCTGCTGAGGGAGATGTGGG - Intergenic
1190029912 X:46962129-46962151 GTGGCTGCCCAGGAAGATGGAGG + Intronic
1190276909 X:48904804-48904826 GTGGCTGCCCGGGAGGCTGCTGG + Exonic
1191144879 X:57155338-57155360 GTGGCTGCTATGGCAGATGGGGG + Intergenic
1191223255 X:58014231-58014253 GTGGCTGCTGTGGGAGATGGGGG + Intergenic
1194051896 X:89079581-89079603 GTGGCTGCTCAGGGAGGGGGAGG - Intergenic
1194116077 X:89900007-89900029 GAGGGTGCCCAAGATGATGGGGG + Intergenic
1197476312 X:126929616-126929638 GTGGCTGCTGTGGAGGATGGGGG + Intergenic
1200135314 X:153871875-153871897 ATGGCTGAGCAGGAAGGTGGCGG - Intronic
1200468875 Y:3557132-3557154 GAGGGTGCCCAAGATGATGGGGG + Intergenic
1201154639 Y:11118837-11118859 GTGGTTGCCTATGAACATGGGGG - Intergenic
1201306696 Y:12556637-12556659 GTGGCTGCTGTGGGAGATGGGGG - Intergenic
1201438705 Y:13985863-13985885 GTTGCTGCTCAGGGAGATAGGGG + Exonic
1201445868 Y:14056845-14056867 GTTGCTGCTCAGGGAGATAGGGG - Exonic