ID: 1190035523

View in Genome Browser
Species Human (GRCh38)
Location X:47019788-47019810
Sequence TACTGCTGTGCCAACTAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 79}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190035523_1190035526 -6 Left 1190035523 X:47019788-47019810 CCTCCTTAGTTGGCACAGCAGTA 0: 1
1: 0
2: 0
3: 11
4: 79
Right 1190035526 X:47019805-47019827 GCAGTATCCACAAAGGCCAGAGG 0: 1
1: 0
2: 2
3: 38
4: 202
1190035523_1190035529 15 Left 1190035523 X:47019788-47019810 CCTCCTTAGTTGGCACAGCAGTA 0: 1
1: 0
2: 0
3: 11
4: 79
Right 1190035529 X:47019826-47019848 GGTAGTAGTGTTCCAGCCACTGG 0: 1
1: 0
2: 0
3: 7
4: 99
1190035523_1190035530 25 Left 1190035523 X:47019788-47019810 CCTCCTTAGTTGGCACAGCAGTA 0: 1
1: 0
2: 0
3: 11
4: 79
Right 1190035530 X:47019836-47019858 TTCCAGCCACTGGTCTCCCCTGG 0: 1
1: 0
2: 2
3: 38
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190035523 Original CRISPR TACTGCTGTGCCAACTAAGG AGG (reversed) Intronic
901965596 1:12863463-12863485 TACTGCCCTGCCAACTCAGGAGG - Intronic
901980993 1:13033841-13033863 TACTGCCCTGCCAACTCAGGAGG - Intronic
901988447 1:13093399-13093421 TACTGCCCTGCCAACTTGGGAGG + Intergenic
901993365 1:13133368-13133390 TACTGCCCTGCCAACTTGGGAGG - Intergenic
902001094 1:13195089-13195111 TACTGCCCTGCCAACTCAGGAGG + Intergenic
902020325 1:13340793-13340815 TACTGCCCTGCCAACTCAGGAGG + Intergenic
903101615 1:21035342-21035364 TCCTGCCCTGCCAACTCAGGAGG - Intronic
905373105 1:37497491-37497513 TATTGCTCTGCCACCTAAGTAGG + Intronic
909438294 1:75669510-75669532 CACTACTGTCCCAACTTAGGAGG + Intergenic
910991527 1:93061560-93061582 TCCTGTTGTCCCAACTCAGGAGG - Intergenic
912752532 1:112297682-112297704 TATTGCTGTGAGAACTAAGCGGG + Intergenic
918671911 1:187228026-187228048 TACTTGGGTGCCAAGTAAGGAGG + Intergenic
921999295 1:221458588-221458610 TACTGCAGGGCATACTAAGGAGG - Intergenic
922226450 1:223650004-223650026 TACAGCTGTGAAAACTGAGGTGG + Intronic
922709777 1:227817543-227817565 AAATGCTCTGCCAGCTAAGGGGG + Intronic
924797071 1:247300288-247300310 TTCTGCTGTGCCAAAAAACGGGG - Exonic
1063559960 10:7116657-7116679 AAGAGCTGTGCCAACTATGGTGG + Intergenic
1070397416 10:76023606-76023628 TACTGTTTTGTAAACTAAGGCGG - Intronic
1082013827 11:47469625-47469647 TACTGCTGTGCTAACTCACTGGG + Intronic
1084194573 11:67517126-67517148 AACTACAGTGCCAACTAGGGAGG - Intergenic
1085284354 11:75350454-75350476 GGCTGCTGTGCCCACTTAGGGGG + Intronic
1088567104 11:111183961-111183983 AAGTGCTGTGTCACCTAAGGAGG + Intergenic
1088710416 11:112503402-112503424 TATTTCTGTCCCACCTAAGGGGG - Intergenic
1090046698 11:123341993-123342015 TATTGCTGTGCCAAGCACGGTGG + Intergenic
1096727466 12:53576260-53576282 GACTGCTGTGCCGTCTAAGGAGG - Intronic
1097199558 12:57266736-57266758 TACTGCTGTGGCATCTGTGGTGG + Exonic
1097228927 12:57497025-57497047 TACTGCTGTGGCAAGTATAGAGG - Intronic
1099614662 12:84919167-84919189 TACACCTGAGCCAACCAAGGTGG + Intergenic
1102898997 12:116621531-116621553 TACTGCTGTGACAACTTAGTGGG + Intergenic
1103036947 12:117664422-117664444 TCCTGCTGAGCCAGCCAAGGGGG - Intronic
1104778812 12:131406628-131406650 TGCTGCTGTTTAAACTAAGGTGG + Intergenic
1110577693 13:77078848-77078870 TACTGCTTTGCCAGTTAAGAAGG + Exonic
1111167473 13:84479015-84479037 TTCTGCTTTCCCAACCAAGGAGG + Intergenic
1112095568 13:96128488-96128510 TCCTGAGGAGCCAACTAAGGAGG - Intronic
1113191385 13:107751092-107751114 TCCTCCAGTGCAAACTAAGGAGG + Intronic
1113804923 13:113107008-113107030 TACTGCAGTGCCCCCCAAGGAGG + Intronic
1121735133 14:96213149-96213171 TACTGCTGTGCCAACACAATAGG + Intronic
1127316048 15:57794833-57794855 TACTGCTGTGCTAACCACGGAGG - Intergenic
1133809706 16:9151977-9151999 GACTGCTGTGCCACCTAGGCTGG + Intergenic
1138301018 16:55929964-55929986 CACTGCTGGGCCAAGGAAGGTGG - Intronic
1147362726 17:39941834-39941856 TACCGGTCTGCAAACTAAGGAGG + Intronic
1156300556 18:35832698-35832720 TACTGCTGTGCAGAGTAAGTGGG + Intergenic
1156490251 18:37491801-37491823 TACTGCTGTGGCCAAGAAGGTGG + Intronic
1157944083 18:51959156-51959178 TAGAGCTGTGCCAAGGAAGGTGG + Intergenic
1157963321 18:52181148-52181170 TACTGCTGTACCACCAAGGGTGG - Intergenic
1159609286 18:70508523-70508545 CCCTGCTGTGCCACCCAAGGAGG + Intergenic
1160379923 18:78446412-78446434 TACTGCTGTTACAACTCAGGTGG - Intergenic
1166897344 19:46032371-46032393 TACAGCTGTGCCCAGGAAGGTGG - Intergenic
928001953 2:27531083-27531105 TACTGCTCTGTCACCTAAGCTGG - Intergenic
928917542 2:36489207-36489229 TACTGATAGGCAAACTAAGGGGG - Intronic
930645497 2:53902035-53902057 TCCTGCTGTGTCACCTAAGCTGG - Intronic
937940093 2:127278644-127278666 TAAAGCTCTGCCAAGTAAGGAGG - Intronic
946279320 2:218655319-218655341 TACTACAGTGCCAACTGAAGTGG + Intronic
947107746 2:226685487-226685509 TACTGCTGTACAAATCAAGGTGG - Intergenic
1169022664 20:2341095-2341117 GACTGCTGTTGCACCTAAGGTGG + Intergenic
1170221442 20:13946659-13946681 TACAGCTGTGCCCAGGAAGGTGG - Intronic
1170922577 20:20692557-20692579 TACTGCTGAGCCAATTATGGTGG + Intronic
1171981506 20:31632375-31632397 ACCTGCAGTCCCAACTAAGGAGG - Intergenic
1173836647 20:46130378-46130400 TCCTGCTGAGCCAACTGAGGGGG + Intergenic
1175139802 20:56852558-56852580 TCCTGCTGTGGCAGCTACGGAGG + Intergenic
1180666668 22:17518704-17518726 TCCTGCTGTGCCAACTGCTGAGG - Intronic
950832186 3:15885834-15885856 TAATGCTTTGCCAACTAACTGGG - Intergenic
953054079 3:39373538-39373560 TACTGCTGTGCCCAGTGTGGTGG - Intergenic
953191007 3:40688174-40688196 TAGTCCTGGACCAACTAAGGTGG - Intergenic
953537154 3:43785139-43785161 GACTGCTGTGCCCACTAAATGGG - Intergenic
957442570 3:80269046-80269068 TACTGGTGTAACAAGTAAGGTGG - Intergenic
959994943 3:112670189-112670211 TTCTGTTCTGCCAAGTAAGGTGG - Intergenic
965550037 3:169955018-169955040 GACTCCTGTGCCAGCCAAGGTGG - Intergenic
965984734 3:174737050-174737072 TCCTGCCCTGCCAACTCAGGAGG + Intronic
967141611 3:186566554-186566576 TAGAGCTGTGCCAGCTAAGTAGG - Intronic
981025223 4:140071003-140071025 TAATAATGTGCCACCTAAGGAGG + Intronic
992365693 5:76086874-76086896 TACTGCTGTCCCTAATTAGGAGG - Intronic
999539959 5:152560577-152560599 TACTGCAGTGCCATGTAAGCAGG + Intergenic
1006491814 6:34394093-34394115 TCTTGCTGTGTCAATTAAGGTGG + Intronic
1012697920 6:102413004-102413026 TAGTGCTGTGGCTACTAAGGTGG - Intergenic
1019897732 7:3995489-3995511 CACTGCTGAGGCAACTCAGGAGG - Intronic
1022333298 7:29400004-29400026 TTCTGCTGCACCAACTAGGGCGG + Intronic
1027728509 7:81839432-81839454 TACCGCTGTCCCACCTAAAGTGG + Intergenic
1028255493 7:88591579-88591601 TACTGCTGTCCCATGTAGGGAGG - Intergenic
1045267947 8:100636419-100636441 TACAGCTGTGTCACCTAAAGCGG + Intronic
1045349015 8:101321405-101321427 TTCTGCTGTGCCTATCAAGGAGG - Intergenic
1045989777 8:108292491-108292513 TACTTCTGGGCCAACTGAAGAGG + Intronic
1046002528 8:108438443-108438465 TACAGTTGTGCCAGCAAAGGGGG + Intergenic
1048285261 8:133136649-133136671 TATTGCTGTCCCAACAAAGCTGG + Intergenic
1049660841 8:143819081-143819103 TCATGCTGGGCCAACTCAGGTGG + Intronic
1189458414 X:41215626-41215648 TACTGTTGTTCCCACGAAGGTGG - Intronic
1189663232 X:43326281-43326303 TGCTGATGTTCCAACTAGGGAGG + Intergenic
1190035523 X:47019788-47019810 TACTGCTGTGCCAACTAAGGAGG - Intronic
1190591551 X:52007692-52007714 AACTGATCTGCCAACAAAGGGGG + Intergenic
1198115666 X:133542572-133542594 TACTGCTGAGCCAAGCATGGGGG + Intronic
1202196251 Y:22300852-22300874 TCCTGCTCTGTCACCTAAGGTGG - Intergenic