ID: 1190037596

View in Genome Browser
Species Human (GRCh38)
Location X:47040211-47040233
Sequence CCCTCTTCACCAAAGAAGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 140}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190037596_1190037603 19 Left 1190037596 X:47040211-47040233 CCGACCTTCTTTGGTGAAGAGGG 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1190037603 X:47040253-47040275 GTCCGCAACCTGCCACAGACAGG 0: 1
1: 0
2: 0
3: 5
4: 98
1190037596_1190037602 -3 Left 1190037596 X:47040211-47040233 CCGACCTTCTTTGGTGAAGAGGG 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1190037602 X:47040231-47040253 GGGGACATTGCACAGTGCAGGGG 0: 1
1: 0
2: 1
3: 16
4: 243
1190037596_1190037600 -5 Left 1190037596 X:47040211-47040233 CCGACCTTCTTTGGTGAAGAGGG 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1190037600 X:47040229-47040251 GAGGGGACATTGCACAGTGCAGG 0: 1
1: 0
2: 0
3: 21
4: 179
1190037596_1190037601 -4 Left 1190037596 X:47040211-47040233 CCGACCTTCTTTGGTGAAGAGGG 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1190037601 X:47040230-47040252 AGGGGACATTGCACAGTGCAGGG 0: 1
1: 0
2: 0
3: 16
4: 230
1190037596_1190037605 25 Left 1190037596 X:47040211-47040233 CCGACCTTCTTTGGTGAAGAGGG 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1190037605 X:47040259-47040281 AACCTGCCACAGACAGGTACTGG 0: 1
1: 0
2: 9
3: 132
4: 433

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190037596 Original CRISPR CCCTCTTCACCAAAGAAGGT CGG (reversed) Intronic
900193963 1:1364542-1364564 CCCTCCTCACCAAGGGAGGTCGG + Intergenic
901490778 1:9595280-9595302 TCCTCTCCACCAGAGAGGGTTGG + Intronic
903264320 1:22148034-22148056 CGCTCTTCACCCGAGAATGTGGG - Intergenic
903318138 1:22524955-22524977 CCATCTTCTCCAGAGAGGGTGGG + Intronic
903938099 1:26910587-26910609 CCCTCTTCACCATAACAGTTTGG - Intronic
905315212 1:37078560-37078582 CCTTCTTCAACAAAGAAGAAAGG - Intergenic
905651266 1:39658629-39658651 CCCTTTTAGCCAAAGAAGCTTGG - Intergenic
910636118 1:89409959-89409981 CACACTTCACAAAAGCAGGTGGG - Intergenic
913532538 1:119743032-119743054 CCCTCCTCACCAATCATGGTAGG - Exonic
915299851 1:154945734-154945756 CCATCCTCACCAAAGAAAGCAGG + Exonic
916077930 1:161213628-161213650 CCCTGTTCAAGGAAGAAGGTTGG - Exonic
916488327 1:165278983-165279005 TACTCTGCATCAAAGAAGGTAGG + Intronic
918643667 1:186876451-186876473 CCCTATTCCCTAGAGAAGGTGGG + Intronic
920048246 1:203147462-203147484 CTCTCTTCCCCAAACAAGGTTGG + Intronic
920059840 1:203219682-203219704 GCCCCTTCACCAAGGAAGGAGGG - Exonic
1063868060 10:10388635-10388657 CACTATACACCAAAGGAGGTAGG - Intergenic
1064063159 10:12157077-12157099 ACCTTTTCACCAAAGTAAGTGGG + Intronic
1065666127 10:28063495-28063517 CGCACTTTACCAAAGAAGATCGG + Intronic
1069825792 10:71254329-71254351 TCCTGATCACCACAGAAGGTTGG - Intronic
1071288881 10:84173904-84173926 CCATCTTCTCCACAGAAGGTAGG + Exonic
1071366807 10:84908280-84908302 GCCTCTTCCCCCAAGAAGGCTGG - Intergenic
1072791473 10:98321234-98321256 GCATGTTCACCACAGAAGGTAGG - Intergenic
1073215792 10:101835440-101835462 CCCTCCTCTCCCAAGAAGCTTGG - Intronic
1075384991 10:122049160-122049182 CCCTTTTCACCTTAGCAGGTGGG - Intronic
1075827833 10:125375234-125375256 CCCTGTTCAGCAAAGTAGGTTGG - Intergenic
1076128183 10:127992526-127992548 GCCTCTTCACCAGGGAAGCTCGG - Intronic
1084926924 11:72521419-72521441 CCCTCTTCACCAAGAAATGGTGG - Intergenic
1086733121 11:90273005-90273027 ACCTCTTCAAAAAGGAAGGTTGG - Intergenic
1088825418 11:113489852-113489874 CTCTCTATACCAAAGAAGGAAGG - Intergenic
1088900731 11:114115056-114115078 CCCTCTTAACAAAAGAAGAAAGG - Intronic
1096636913 12:52965823-52965845 CCCTCGTCTCCTAAGAGGGTGGG + Intergenic
1102694978 12:114791800-114791822 CCCTACTCATGAAAGAAGGTCGG + Intergenic
1103503548 12:121424402-121424424 CCCTCTTCAGAAGAGATGGTGGG + Intronic
1104429285 12:128703783-128703805 TCCTCTTCCACAAAGTAGGTTGG - Intronic
1104724131 12:131065785-131065807 CTCTCTTCCCCACATAAGGTAGG + Intronic
1105864608 13:24448093-24448115 CCCTCATCCCCCAAGTAGGTGGG - Intronic
1110455330 13:75684621-75684643 CCCTATTTACCTAAGAAGGTTGG - Intronic
1111670789 13:91327299-91327321 CCATCTTTACCAAAGAAGCAGGG + Intergenic
1112801172 13:103111044-103111066 CCCCTTTCACCTAGGAAGGTTGG + Intergenic
1112867442 13:103922721-103922743 ACCTCTTCACTAAAAAATGTTGG - Intergenic
1113304063 13:109057688-109057710 CCATCTACACTTAAGAAGGTGGG - Intronic
1117077038 14:52115271-52115293 GCCACTGCACCCAAGAAGGTTGG + Intergenic
1118051205 14:62030064-62030086 GCCTCTTCATGGAAGAAGGTGGG - Intronic
1129504083 15:76066577-76066599 CCCTCTTCACCAGGGCAGGAAGG - Intronic
1129966170 15:79737750-79737772 CTCTCTTCTCCCAAGAAGCTAGG + Intergenic
1130310934 15:82753620-82753642 CCCTCTTCCCCAAACAACTTTGG - Intergenic
1132581294 16:685864-685886 CACTCATCACCAATGAGGGTAGG - Exonic
1135174707 16:20217518-20217540 ACCTCTTAACCATACAAGGTAGG - Intergenic
1135665112 16:24329056-24329078 CCTTCTTCACCCAAGAAGCCTGG + Intronic
1135940016 16:26814506-26814528 CCCTCATCAACAGAGAAGGAAGG + Intergenic
1136269397 16:29139566-29139588 CTCTCTTGACCAGACAAGGTAGG + Intergenic
1136542308 16:30934905-30934927 CCCTCTTCATCAAAGCTGCTTGG - Intronic
1142072875 16:88100836-88100858 CTCTCTTGACCAGACAAGGTAGG + Intronic
1145304087 17:21662367-21662389 CCCTCGACAAAAAAGAAGGTAGG - Intergenic
1145827184 17:27885806-27885828 CCCCTTTCACCAAAGCAGCTGGG + Intronic
1148825280 17:50388615-50388637 CACTCTTCTCCAACTAAGGTTGG - Intronic
1151514221 17:74581715-74581737 CCCTCTTGACCCCAGGAGGTGGG + Intronic
1151615633 17:75208603-75208625 CCTCCTTCAACAAAAAAGGTAGG + Exonic
1152232949 17:79124025-79124047 CCCTCTTCAACACAGCAGGCAGG + Intronic
1152316986 17:79586763-79586785 CACTCTCCAACAAACAAGGTGGG - Intergenic
1152702178 17:81824594-81824616 CCCTCTCCAGCACAGAAGGAGGG + Exonic
1153595498 18:6721126-6721148 CACTCTTCTCCCAAAAAGGTTGG + Intergenic
1155958691 18:31975681-31975703 CACTCTTCCCCAATGAAGGTGGG + Intergenic
1156753263 18:40487073-40487095 CCCTATTCACCAAAGTATTTGGG + Intergenic
1165976910 19:39684075-39684097 CCATCTTCACATAAGATGGTGGG - Intergenic
928437163 2:31262021-31262043 CCCACTGCACCAGAGATGGTGGG - Intronic
928606390 2:32947710-32947732 CCCCGTTCACCAAACAAGGCAGG + Exonic
928762511 2:34601423-34601445 CCCTCTTCCCCACAGAAAGCTGG - Intergenic
934165800 2:89293134-89293156 CCCTCTACACCAAAGGAGAAGGG + Intergenic
934201477 2:89889322-89889344 CCCTCTACACCAAAGGAGAAGGG - Intergenic
940154660 2:150642591-150642613 CCCTCCTAATCAAAGAATGTTGG + Intergenic
943560075 2:189450650-189450672 CCCTCTTCAAGACAGAAAGTTGG + Intronic
945648675 2:212534353-212534375 CCCTCTTGACCAAGGAAGGAAGG - Intronic
946729043 2:222690811-222690833 CCCTCTTAACCACCGAAAGTGGG + Intronic
946961737 2:224992691-224992713 ACCTCTTCACACAAGAAGGAAGG - Intronic
1169142377 20:3233786-3233808 CCCTCTTCTCCCAAGTTGGTTGG + Intronic
1169933147 20:10855400-10855422 ATCTCTTCACTAAAGAATGTTGG - Intergenic
1171521644 20:25780185-25780207 CCCTCGACAAAAAAGAAGGTAGG - Intronic
1171555197 20:26075866-26075888 CCCTCGACAAAAAAGAAGGTAGG + Intergenic
1172030661 20:31979975-31979997 CCCTCTTCAGCAAAGCATTTGGG - Intronic
1175266218 20:57704956-57704978 CCCTCTCCATAAAAGAAGGAAGG - Intronic
1175451841 20:59076032-59076054 CCCCCTTCCCCAAAGAAGGGAGG + Intergenic
1176655447 21:9585109-9585131 CCCTCGACAAAAAAGAAGGTAGG - Intergenic
1179137655 21:38694642-38694664 TCCTCTTCTCCAAAGGAGTTTGG - Intergenic
951923859 3:27886117-27886139 CTCTCTTCACCAAACAATGAGGG - Intergenic
953819318 3:46191129-46191151 TCCTCTTGACCAACAAAGGTTGG - Intronic
956080650 3:65552184-65552206 TCCTCTTCATCAGAGAGGGTGGG - Intronic
959962341 3:112312777-112312799 CACACTTCACAAAAGAAGGTGGG - Intergenic
964770585 3:160220858-160220880 CCCTTTTCACCAATGAAGATAGG - Intergenic
968985757 4:3873543-3873565 CCCTCTTCACACAAGAGGGCAGG - Intergenic
971976555 4:33696600-33696622 CCCTTTTCACCAAAAAAGTGTGG - Intergenic
972149635 4:36073101-36073123 GCCTCTTCAGCAAAGAACATAGG - Intronic
974047218 4:56908192-56908214 CCCTCCTCACCGAGGAAGGCCGG + Exonic
974674370 4:65071537-65071559 CCCTTCTCACCAATGAATGTTGG - Intergenic
977769290 4:100838215-100838237 TTCTCTCCACAAAAGAAGGTTGG - Intronic
979165332 4:117521814-117521836 CCCTCTTCAACAAATAATGCCGG - Intergenic
980156507 4:129114265-129114287 ACCTCTTGACCAAAGAGGGTGGG + Exonic
980528848 4:134024494-134024516 CCCTCTTCACCCATGAACATTGG - Intergenic
980992385 4:139748938-139748960 CTCTATTCACCAAAGAAGCAGGG - Intronic
987315851 5:16723017-16723039 GACACTTCACCAAAGAAGATAGG + Intronic
988079303 5:26396066-26396088 CCCTCTTCACCATAGTATGCTGG + Intergenic
988696143 5:33624344-33624366 CTCTCTTCCCCACAGATGGTTGG - Exonic
991238190 5:64423754-64423776 CCCTATTCAGCAAAGGAGCTGGG + Intergenic
994888138 5:105593233-105593255 CCCTCTTCCCCAAAAGAGGACGG + Intergenic
995177686 5:109197777-109197799 CATTCACCACCAAAGAAGGTTGG + Intergenic
997646713 5:135486973-135486995 CCTTCTTCACGGATGAAGGTAGG - Intergenic
1001108838 5:168878448-168878470 CCCTATTCACCTAAGCAAGTAGG - Intronic
1003260144 6:4509636-4509658 CCATCATCTCCAAAGAAGGCAGG - Intergenic
1004385685 6:15170792-15170814 CCCCCCTCAGCACAGAAGGTTGG - Intergenic
1004788182 6:18992376-18992398 CCCTCTTTACCAAACAAGCAAGG + Intergenic
1004886945 6:20060200-20060222 CCCAGTTTACCAAGGAAGGTGGG + Intergenic
1007993377 6:46280756-46280778 TCCTCTTCAATAAAGAAGTTGGG + Intronic
1015378969 6:132545089-132545111 CCCTCTTCAACAAAGGAGTCTGG - Intergenic
1016393211 6:143595687-143595709 TCCTCTTCACGAAAGAGGGCTGG - Intronic
1016633172 6:146256034-146256056 CCCTCTACCAAAAAGAAGGTTGG - Intronic
1017631494 6:156400629-156400651 CCCTCTTACTCAAAGAAGATTGG + Intergenic
1017801970 6:157905026-157905048 CCCTTATCACCTTAGAAGGTAGG + Intronic
1020686859 7:11307104-11307126 CCCTCTCCAACAATGATGGTGGG + Intergenic
1023141336 7:37105353-37105375 ACTTCCCCACCAAAGAAGGTAGG + Intronic
1023642334 7:42272415-42272437 CCCTTTACAACAAAGTAGGTAGG - Intergenic
1025282093 7:57634959-57634981 CCCTCGACAAAAAAGAAGGTAGG - Intergenic
1025302637 7:57830558-57830580 CCCTCGACAAAAAAGAAGGTAGG + Intergenic
1028260320 7:88656295-88656317 TCCTCTTCACCATAGGAGATGGG + Intergenic
1029695921 7:102213181-102213203 CAATCTCCACCAAAGGAGGTGGG - Intronic
1031529774 7:122862431-122862453 CCCTCCTTGCCACAGAAGGTGGG + Intronic
1031654928 7:124343148-124343170 CCCTCTTCACCACACACTGTGGG + Intergenic
1033480040 7:141730524-141730546 CCCACTTCCTCAAAGAAGCTGGG - Exonic
1035133252 7:156675302-156675324 CCCTCGTCTCCAAAGACGGAGGG - Intronic
1036962454 8:13259823-13259845 CCTTCTTCACCTAAGTAGATAGG - Intronic
1038335698 8:26643706-26643728 CCTTGTTCACCAAACTAGGTTGG + Intronic
1039075369 8:33686048-33686070 CCATCTTCACAAAAGAAACTTGG - Intergenic
1043400954 8:79883866-79883888 CCGTCTCTACCAAAGAAGGAAGG - Intergenic
1044105328 8:88198028-88198050 CCCCCTTCACCAGGGAAGGTGGG - Intronic
1044553396 8:93536365-93536387 CTCTCTCCTCCACAGAAGGTGGG + Intergenic
1046581148 8:116093870-116093892 CTCTCTTCCCCTAAGAAAGTGGG + Intergenic
1048551531 8:135437816-135437838 GGCTCATCACCAAAAAAGGTAGG - Intergenic
1049319962 8:141991043-141991065 CCGTCTCCACCAAAGGGGGTGGG + Intergenic
1050183594 9:2947100-2947122 CACTCTTCACCAGAGAAAGTTGG - Intergenic
1050495583 9:6238304-6238326 CATTCTTGACCAAAAAAGGTAGG + Intronic
1052202078 9:25794897-25794919 GCCTCTTAATCAATGAAGGTAGG - Intergenic
1052935793 9:34092049-34092071 CCCTCTTCAATAAAGAATGAGGG + Intronic
1055785850 9:79867973-79867995 CCCGCTTCACCAAGAGAGGTTGG + Intergenic
1056986605 9:91369335-91369357 CCCTTTACTCCATAGAAGGTTGG - Intergenic
1060434690 9:123583331-123583353 GCCTCTTCCCCAGAGAAGGCAGG - Intronic
1061042878 9:128149901-128149923 CCCCATTGTCCAAAGAAGGTGGG + Intronic
1061599195 9:131655492-131655514 CTCTCTTCACCCAAGCAGGGTGG + Intronic
1062197783 9:135284042-135284064 CCTTCTTCAGCAAAGCAGTTTGG - Intergenic
1203633166 Un_KI270750v1:88581-88603 CCCTCGACAAAAAAGAAGGTAGG - Intergenic
1186446921 X:9638071-9638093 CCTGCTTCTCCAAAGAAAGTAGG - Intronic
1190037596 X:47040211-47040233 CCCTCTTCACCAAAGAAGGTCGG - Intronic
1193611205 X:83633368-83633390 CTGTCTCCACAAAAGAAGGTGGG + Intergenic
1195216967 X:102712409-102712431 GCCTCTGCACCAAAGTAGGCAGG - Exonic
1198238818 X:134763290-134763312 TCCTCTTGCCCAAAGAAGGCAGG + Intronic
1200333093 X:155318968-155318990 CCCTATTCAACAAATAATGTCGG + Intronic