ID: 1190044541

View in Genome Browser
Species Human (GRCh38)
Location X:47101473-47101495
Sequence GTAGTTATTGGAAAGCCGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190044541_1190044551 13 Left 1190044541 X:47101473-47101495 CCAGCCGGCTTTCCAATAACTAC No data
Right 1190044551 X:47101509-47101531 CCCAGTTTATCACATGGAGGAGG No data
1190044541_1190044549 10 Left 1190044541 X:47101473-47101495 CCAGCCGGCTTTCCAATAACTAC No data
Right 1190044549 X:47101506-47101528 CGGCCCAGTTTATCACATGGAGG No data
1190044541_1190044548 7 Left 1190044541 X:47101473-47101495 CCAGCCGGCTTTCCAATAACTAC No data
Right 1190044548 X:47101503-47101525 TTACGGCCCAGTTTATCACATGG No data
1190044541_1190044553 27 Left 1190044541 X:47101473-47101495 CCAGCCGGCTTTCCAATAACTAC No data
Right 1190044553 X:47101523-47101545 TGGAGGAGGCTGAAGAGTGATGG No data
1190044541_1190044546 -10 Left 1190044541 X:47101473-47101495 CCAGCCGGCTTTCCAATAACTAC No data
Right 1190044546 X:47101486-47101508 CAATAACTACCAGGGACTTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190044541 Original CRISPR GTAGTTATTGGAAAGCCGGC TGG (reversed) Intergenic