ID: 1190044542

View in Genome Browser
Species Human (GRCh38)
Location X:47101477-47101499
Sequence CCTGGTAGTTATTGGAAAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190044542_1190044553 23 Left 1190044542 X:47101477-47101499 CCGGCTTTCCAATAACTACCAGG No data
Right 1190044553 X:47101523-47101545 TGGAGGAGGCTGAAGAGTGATGG No data
1190044542_1190044549 6 Left 1190044542 X:47101477-47101499 CCGGCTTTCCAATAACTACCAGG No data
Right 1190044549 X:47101506-47101528 CGGCCCAGTTTATCACATGGAGG No data
1190044542_1190044548 3 Left 1190044542 X:47101477-47101499 CCGGCTTTCCAATAACTACCAGG No data
Right 1190044548 X:47101503-47101525 TTACGGCCCAGTTTATCACATGG No data
1190044542_1190044551 9 Left 1190044542 X:47101477-47101499 CCGGCTTTCCAATAACTACCAGG No data
Right 1190044551 X:47101509-47101531 CCCAGTTTATCACATGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190044542 Original CRISPR CCTGGTAGTTATTGGAAAGC CGG (reversed) Intergenic