ID: 1190044545

View in Genome Browser
Species Human (GRCh38)
Location X:47101485-47101507
Sequence CGTAAGTCCCTGGTAGTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190044545_1190044554 25 Left 1190044545 X:47101485-47101507 CCAATAACTACCAGGGACTTACG No data
Right 1190044554 X:47101533-47101555 TGAAGAGTGATGGAACCCCATGG No data
1190044545_1190044548 -5 Left 1190044545 X:47101485-47101507 CCAATAACTACCAGGGACTTACG No data
Right 1190044548 X:47101503-47101525 TTACGGCCCAGTTTATCACATGG No data
1190044545_1190044553 15 Left 1190044545 X:47101485-47101507 CCAATAACTACCAGGGACTTACG No data
Right 1190044553 X:47101523-47101545 TGGAGGAGGCTGAAGAGTGATGG No data
1190044545_1190044555 26 Left 1190044545 X:47101485-47101507 CCAATAACTACCAGGGACTTACG No data
Right 1190044555 X:47101534-47101556 GAAGAGTGATGGAACCCCATGGG No data
1190044545_1190044551 1 Left 1190044545 X:47101485-47101507 CCAATAACTACCAGGGACTTACG No data
Right 1190044551 X:47101509-47101531 CCCAGTTTATCACATGGAGGAGG No data
1190044545_1190044549 -2 Left 1190044545 X:47101485-47101507 CCAATAACTACCAGGGACTTACG No data
Right 1190044549 X:47101506-47101528 CGGCCCAGTTTATCACATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190044545 Original CRISPR CGTAAGTCCCTGGTAGTTAT TGG (reversed) Intergenic