ID: 1190044547

View in Genome Browser
Species Human (GRCh38)
Location X:47101495-47101517
Sequence TAAACTGGGCCGTAAGTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190044547_1190044553 5 Left 1190044547 X:47101495-47101517 CCAGGGACTTACGGCCCAGTTTA No data
Right 1190044553 X:47101523-47101545 TGGAGGAGGCTGAAGAGTGATGG No data
1190044547_1190044556 29 Left 1190044547 X:47101495-47101517 CCAGGGACTTACGGCCCAGTTTA No data
Right 1190044556 X:47101547-47101569 ACCCCATGGGATGACCCCAGTGG No data
1190044547_1190044551 -9 Left 1190044547 X:47101495-47101517 CCAGGGACTTACGGCCCAGTTTA No data
Right 1190044551 X:47101509-47101531 CCCAGTTTATCACATGGAGGAGG No data
1190044547_1190044554 15 Left 1190044547 X:47101495-47101517 CCAGGGACTTACGGCCCAGTTTA No data
Right 1190044554 X:47101533-47101555 TGAAGAGTGATGGAACCCCATGG No data
1190044547_1190044555 16 Left 1190044547 X:47101495-47101517 CCAGGGACTTACGGCCCAGTTTA No data
Right 1190044555 X:47101534-47101556 GAAGAGTGATGGAACCCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190044547 Original CRISPR TAAACTGGGCCGTAAGTCCC TGG (reversed) Intergenic