ID: 1190044551

View in Genome Browser
Species Human (GRCh38)
Location X:47101509-47101531
Sequence CCCAGTTTATCACATGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190044545_1190044551 1 Left 1190044545 X:47101485-47101507 CCAATAACTACCAGGGACTTACG No data
Right 1190044551 X:47101509-47101531 CCCAGTTTATCACATGGAGGAGG No data
1190044538_1190044551 27 Left 1190044538 X:47101459-47101481 CCCACTCCATGCAGCCAGCCGGC No data
Right 1190044551 X:47101509-47101531 CCCAGTTTATCACATGGAGGAGG No data
1190044542_1190044551 9 Left 1190044542 X:47101477-47101499 CCGGCTTTCCAATAACTACCAGG No data
Right 1190044551 X:47101509-47101531 CCCAGTTTATCACATGGAGGAGG No data
1190044547_1190044551 -9 Left 1190044547 X:47101495-47101517 CCAGGGACTTACGGCCCAGTTTA No data
Right 1190044551 X:47101509-47101531 CCCAGTTTATCACATGGAGGAGG No data
1190044540_1190044551 21 Left 1190044540 X:47101465-47101487 CCATGCAGCCAGCCGGCTTTCCA No data
Right 1190044551 X:47101509-47101531 CCCAGTTTATCACATGGAGGAGG No data
1190044541_1190044551 13 Left 1190044541 X:47101473-47101495 CCAGCCGGCTTTCCAATAACTAC No data
Right 1190044551 X:47101509-47101531 CCCAGTTTATCACATGGAGGAGG No data
1190044539_1190044551 26 Left 1190044539 X:47101460-47101482 CCACTCCATGCAGCCAGCCGGCT No data
Right 1190044551 X:47101509-47101531 CCCAGTTTATCACATGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190044551 Original CRISPR CCCAGTTTATCACATGGAGG AGG Intergenic