ID: 1190044552

View in Genome Browser
Species Human (GRCh38)
Location X:47101510-47101532
Sequence GCCTCCTCCATGTGATAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190044552_1190044562 27 Left 1190044552 X:47101510-47101532 CCAGTTTATCACATGGAGGAGGC No data
Right 1190044562 X:47101560-47101582 ACCCCAGTGGCCACTGTGAGGGG No data
1190044552_1190044555 1 Left 1190044552 X:47101510-47101532 CCAGTTTATCACATGGAGGAGGC No data
Right 1190044555 X:47101534-47101556 GAAGAGTGATGGAACCCCATGGG No data
1190044552_1190044553 -10 Left 1190044552 X:47101510-47101532 CCAGTTTATCACATGGAGGAGGC No data
Right 1190044553 X:47101523-47101545 TGGAGGAGGCTGAAGAGTGATGG No data
1190044552_1190044566 29 Left 1190044552 X:47101510-47101532 CCAGTTTATCACATGGAGGAGGC No data
Right 1190044566 X:47101562-47101584 CCCAGTGGCCACTGTGAGGGGGG No data
1190044552_1190044560 25 Left 1190044552 X:47101510-47101532 CCAGTTTATCACATGGAGGAGGC No data
Right 1190044560 X:47101558-47101580 TGACCCCAGTGGCCACTGTGAGG No data
1190044552_1190044561 26 Left 1190044552 X:47101510-47101532 CCAGTTTATCACATGGAGGAGGC No data
Right 1190044561 X:47101559-47101581 GACCCCAGTGGCCACTGTGAGGG No data
1190044552_1190044554 0 Left 1190044552 X:47101510-47101532 CCAGTTTATCACATGGAGGAGGC No data
Right 1190044554 X:47101533-47101555 TGAAGAGTGATGGAACCCCATGG No data
1190044552_1190044556 14 Left 1190044552 X:47101510-47101532 CCAGTTTATCACATGGAGGAGGC No data
Right 1190044556 X:47101547-47101569 ACCCCATGGGATGACCCCAGTGG No data
1190044552_1190044564 28 Left 1190044552 X:47101510-47101532 CCAGTTTATCACATGGAGGAGGC No data
Right 1190044564 X:47101561-47101583 CCCCAGTGGCCACTGTGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190044552 Original CRISPR GCCTCCTCCATGTGATAAAC TGG (reversed) Intergenic