ID: 1190044553

View in Genome Browser
Species Human (GRCh38)
Location X:47101523-47101545
Sequence TGGAGGAGGCTGAAGAGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190044547_1190044553 5 Left 1190044547 X:47101495-47101517 CCAGGGACTTACGGCCCAGTTTA No data
Right 1190044553 X:47101523-47101545 TGGAGGAGGCTGAAGAGTGATGG No data
1190044550_1190044553 -9 Left 1190044550 X:47101509-47101531 CCCAGTTTATCACATGGAGGAGG No data
Right 1190044553 X:47101523-47101545 TGGAGGAGGCTGAAGAGTGATGG No data
1190044552_1190044553 -10 Left 1190044552 X:47101510-47101532 CCAGTTTATCACATGGAGGAGGC No data
Right 1190044553 X:47101523-47101545 TGGAGGAGGCTGAAGAGTGATGG No data
1190044542_1190044553 23 Left 1190044542 X:47101477-47101499 CCGGCTTTCCAATAACTACCAGG No data
Right 1190044553 X:47101523-47101545 TGGAGGAGGCTGAAGAGTGATGG No data
1190044541_1190044553 27 Left 1190044541 X:47101473-47101495 CCAGCCGGCTTTCCAATAACTAC No data
Right 1190044553 X:47101523-47101545 TGGAGGAGGCTGAAGAGTGATGG No data
1190044545_1190044553 15 Left 1190044545 X:47101485-47101507 CCAATAACTACCAGGGACTTACG No data
Right 1190044553 X:47101523-47101545 TGGAGGAGGCTGAAGAGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190044553 Original CRISPR TGGAGGAGGCTGAAGAGTGA TGG Intergenic