ID: 1190044556

View in Genome Browser
Species Human (GRCh38)
Location X:47101547-47101569
Sequence ACCCCATGGGATGACCCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190044550_1190044556 15 Left 1190044550 X:47101509-47101531 CCCAGTTTATCACATGGAGGAGG No data
Right 1190044556 X:47101547-47101569 ACCCCATGGGATGACCCCAGTGG No data
1190044552_1190044556 14 Left 1190044552 X:47101510-47101532 CCAGTTTATCACATGGAGGAGGC No data
Right 1190044556 X:47101547-47101569 ACCCCATGGGATGACCCCAGTGG No data
1190044547_1190044556 29 Left 1190044547 X:47101495-47101517 CCAGGGACTTACGGCCCAGTTTA No data
Right 1190044556 X:47101547-47101569 ACCCCATGGGATGACCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190044556 Original CRISPR ACCCCATGGGATGACCCCAG TGG Intergenic