ID: 1190044562

View in Genome Browser
Species Human (GRCh38)
Location X:47101560-47101582
Sequence ACCCCAGTGGCCACTGTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190044550_1190044562 28 Left 1190044550 X:47101509-47101531 CCCAGTTTATCACATGGAGGAGG No data
Right 1190044562 X:47101560-47101582 ACCCCAGTGGCCACTGTGAGGGG No data
1190044552_1190044562 27 Left 1190044552 X:47101510-47101532 CCAGTTTATCACATGGAGGAGGC No data
Right 1190044562 X:47101560-47101582 ACCCCAGTGGCCACTGTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190044562 Original CRISPR ACCCCAGTGGCCACTGTGAG GGG Intergenic