ID: 1190044566

View in Genome Browser
Species Human (GRCh38)
Location X:47101562-47101584
Sequence CCCAGTGGCCACTGTGAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190044557_1190044566 -9 Left 1190044557 X:47101548-47101570 CCCCATGGGATGACCCCAGTGGC No data
Right 1190044566 X:47101562-47101584 CCCAGTGGCCACTGTGAGGGGGG No data
1190044558_1190044566 -10 Left 1190044558 X:47101549-47101571 CCCATGGGATGACCCCAGTGGCC No data
Right 1190044566 X:47101562-47101584 CCCAGTGGCCACTGTGAGGGGGG No data
1190044552_1190044566 29 Left 1190044552 X:47101510-47101532 CCAGTTTATCACATGGAGGAGGC No data
Right 1190044566 X:47101562-47101584 CCCAGTGGCCACTGTGAGGGGGG No data
1190044550_1190044566 30 Left 1190044550 X:47101509-47101531 CCCAGTTTATCACATGGAGGAGG No data
Right 1190044566 X:47101562-47101584 CCCAGTGGCCACTGTGAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190044566 Original CRISPR CCCAGTGGCCACTGTGAGGG GGG Intergenic