ID: 1190047480

View in Genome Browser
Species Human (GRCh38)
Location X:47124281-47124303
Sequence AAGAAGAAAGAGAAAGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190047477_1190047480 4 Left 1190047477 X:47124254-47124276 CCAGCCTGGGTGACAGATCAAGA 0: 202
1: 28815
2: 76752
3: 153805
4: 162157
Right 1190047480 X:47124281-47124303 AAGAAGAAAGAGAAAGAGGCCGG No data
1190047478_1190047480 0 Left 1190047478 X:47124258-47124280 CCTGGGTGACAGATCAAGAAAGA No data
Right 1190047480 X:47124281-47124303 AAGAAGAAAGAGAAAGAGGCCGG No data
1190047476_1190047480 14 Left 1190047476 X:47124244-47124266 CCACTGCACTCCAGCCTGGGTGA 0: 81688
1: 171766
2: 204013
3: 179579
4: 118739
Right 1190047480 X:47124281-47124303 AAGAAGAAAGAGAAAGAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190047480 Original CRISPR AAGAAGAAAGAGAAAGAGGC CGG Intergenic
No off target data available for this crispr