ID: 1190048705

View in Genome Browser
Species Human (GRCh38)
Location X:47133146-47133168
Sequence AAAAAGAAGTAGACTGGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190048700_1190048705 11 Left 1190048700 X:47133112-47133134 CCGGGCAACAGAGCGAGACTCCG 0: 399
1: 3012
2: 8679
3: 13781
4: 16809
Right 1190048705 X:47133146-47133168 AAAAAGAAGTAGACTGGGGCCGG No data
1190048698_1190048705 16 Left 1190048698 X:47133107-47133129 CCAGCCCGGGCAACAGAGCGAGA 0: 161
1: 15053
2: 93456
3: 173430
4: 223848
Right 1190048705 X:47133146-47133168 AAAAAGAAGTAGACTGGGGCCGG No data
1190048697_1190048705 26 Left 1190048697 X:47133097-47133119 CCACTGCACTCCAGCCCGGGCAA 0: 838
1: 69929
2: 179734
3: 228483
4: 191180
Right 1190048705 X:47133146-47133168 AAAAAGAAGTAGACTGGGGCCGG No data
1190048699_1190048705 12 Left 1190048699 X:47133111-47133133 CCCGGGCAACAGAGCGAGACTCC 0: 7799
1: 51257
2: 99726
3: 151223
4: 177000
Right 1190048705 X:47133146-47133168 AAAAAGAAGTAGACTGGGGCCGG No data
1190048701_1190048705 -9 Left 1190048701 X:47133132-47133154 CCGTCTCAAAAAAAAAAAAGAAG 0: 271
1: 10111
2: 101558
3: 76320
4: 94041
Right 1190048705 X:47133146-47133168 AAAAAGAAGTAGACTGGGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190048705 Original CRISPR AAAAAGAAGTAGACTGGGGC CGG Intergenic
No off target data available for this crispr