ID: 1190049990

View in Genome Browser
Species Human (GRCh38)
Location X:47142367-47142389
Sequence GGCCAATGGCCTTCCCATCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 223}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190049990_1190049994 10 Left 1190049990 X:47142367-47142389 CCATGATGGGAAGGCCATTGGCC 0: 1
1: 0
2: 3
3: 29
4: 223
Right 1190049994 X:47142400-47142422 TCACAAGCCTCTCAGCTTCGCGG 0: 1
1: 0
2: 1
3: 4
4: 114
1190049990_1190049996 14 Left 1190049990 X:47142367-47142389 CCATGATGGGAAGGCCATTGGCC 0: 1
1: 0
2: 3
3: 29
4: 223
Right 1190049996 X:47142404-47142426 AAGCCTCTCAGCTTCGCGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 57
1190049990_1190049995 13 Left 1190049990 X:47142367-47142389 CCATGATGGGAAGGCCATTGGCC 0: 1
1: 0
2: 3
3: 29
4: 223
Right 1190049995 X:47142403-47142425 CAAGCCTCTCAGCTTCGCGGCGG 0: 1
1: 0
2: 1
3: 3
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190049990 Original CRISPR GGCCAATGGCCTTCCCATCA TGG (reversed) Exonic
900716800 1:4150269-4150291 GGCCAATTGACTGCCCATAAAGG + Intergenic
900804963 1:4761508-4761530 GGCCAATGGCCATGGCATCATGG - Intronic
905824142 1:41016443-41016465 GGCACATGGCCTGCCCAGCACGG - Intronic
906021241 1:42631540-42631562 GGCCTATGTCCTTCCTTTCAGGG + Intronic
906826974 1:48992546-48992568 GGCCTGTGTCCTTCCCTTCAGGG + Intronic
909270403 1:73617054-73617076 GGCCTGTGTCCTTCCCTTCAGGG + Intergenic
910733211 1:90421340-90421362 GGCCTATAACCTTCCCTTCAGGG - Intergenic
910988336 1:93028123-93028145 AGTCAATGGCCTGACCATCAGGG - Intergenic
911811270 1:102284875-102284897 GGCCTGTGTCCTTCCCTTCATGG - Intergenic
915442228 1:155952279-155952301 GGTGAATGGCATTCCCCTCAGGG - Intronic
919003211 1:191860914-191860936 GGCCTGTGTCCTTCCCTTCAAGG - Intergenic
919067844 1:192715116-192715138 GGCTCATGTCCTTCCCTTCAGGG - Intergenic
920097917 1:203498610-203498632 GGCCAATGGCCCTCGCCCCAGGG - Intronic
921746175 1:218743016-218743038 GGACTATGGCCTTCCTTTCAAGG - Intergenic
921994077 1:221397699-221397721 GGCCTGTGTCCTTCCCTTCAGGG - Intergenic
922642348 1:227246391-227246413 GCCCAAGGCCCTTCCCTTCAGGG - Intronic
924516229 1:244768462-244768484 GGACTGTGTCCTTCCCATCAAGG + Intergenic
924648987 1:245905645-245905667 GGCCTATGCCCTTCCCTTCAGGG - Intronic
1063601323 10:7483634-7483656 GGCCCATGGCTCTGCCATCATGG - Intergenic
1065297711 10:24292430-24292452 GGCAAATGGCCTTCCTGTAAAGG - Intronic
1066649636 10:37642423-37642445 GGCTTATGTCCTTCCCTTCAAGG + Intergenic
1068740357 10:60462130-60462152 GGACCCTGGCCTTCCAATCATGG - Intronic
1069342724 10:67431059-67431081 GGACAATAGCCTTCCCTTAATGG - Intronic
1070328167 10:75401194-75401216 GGCCAACCGCCTGCCAATCAAGG - Exonic
1071896653 10:90075570-90075592 GGCTTATGTCCTTCCCTTCAGGG + Intergenic
1071935437 10:90525819-90525841 GGCTTATGTCCTTCCCTTCAGGG + Intergenic
1072231662 10:93419019-93419041 GCCCCATGGTCTTCCCATCAAGG + Intronic
1072853658 10:98924345-98924367 GCCCAAGGCCCTTCCCGTCAGGG + Intronic
1073905416 10:108274294-108274316 GGCCCATGTCCTTTCCTTCAGGG + Intergenic
1074825302 10:117210452-117210474 GGCCAATGCCCTTTGTATCAGGG + Intergenic
1079183590 11:18215582-18215604 GGCCTGTGTCCTTCCCTTCAGGG - Intronic
1079571946 11:21953604-21953626 GGCCTGTGTCCTTCCCTTCAGGG - Intergenic
1082953869 11:58847765-58847787 GGCCTGTGTGCTTCCCATCAGGG - Intronic
1082970285 11:59013018-59013040 GGCCTGTGTCCTTCCCATCAGGG - Intronic
1083460442 11:62807408-62807430 GGCCACTTGCCTTCCCAGGAGGG + Exonic
1083621567 11:64051856-64051878 GGGCCATGGCCGTCCCATCGTGG + Intronic
1086898040 11:92336085-92336107 GGCCAAAGACCTTCCCATCATGG - Intergenic
1087598308 11:100282649-100282671 GGCCAGTGTCCTTCCTTTCAGGG + Intronic
1088361942 11:109000781-109000803 GGCCTATGTCCTTCCCTTCAGGG + Intergenic
1088570016 11:111213660-111213682 GGCCTATGTCCTTCCCTTCAGGG - Intergenic
1089432826 11:118437065-118437087 GGCGAATGGCTCTCCCATCTTGG + Intronic
1089990574 11:122855608-122855630 GGCCAATGGCCTTGACTTCATGG - Intronic
1090205249 11:124880239-124880261 GGCACATGGCCTTGACATCATGG - Intronic
1091671716 12:2456846-2456868 GGACAAAGCCCTTCCCCTCATGG - Intronic
1093991202 12:25591592-25591614 GGCCTGTGTCCTTCCCTTCAGGG - Intronic
1094258654 12:28465293-28465315 AGCCTATGTCCTTCCCTTCAGGG - Intronic
1094499812 12:31011617-31011639 GGCCTATGGCCTTGCCCTCAGGG + Intergenic
1095227619 12:39695683-39695705 GGCCTGTGTCCTTCCCTTCAGGG - Intronic
1096343863 12:50828328-50828350 GCCCAAGGCCCTTCCCTTCAAGG + Intergenic
1097473160 12:60021212-60021234 GGCCTGTGTCCTTCCCTTCAGGG + Intergenic
1097899173 12:64856655-64856677 GCCCAAGGCCCTTCCCTTCAGGG + Intronic
1098207832 12:68132164-68132186 GGCCTGTGTCCTTCCCTTCAGGG + Intergenic
1099348431 12:81533159-81533181 ATCCAATGCCCTTTCCATCATGG - Intronic
1099433861 12:82620142-82620164 GGCCTATGTCCTTCCCTTCAGGG - Intergenic
1099781750 12:87203471-87203493 GGCGAATGTCCTTCCCTACAGGG - Intergenic
1099826028 12:87779328-87779350 GTCCAAGGCCCTTCCCTTCAGGG + Intergenic
1100360714 12:93877394-93877416 GGCCTGTGACCTTCCCTTCAGGG + Intronic
1101478888 12:105077810-105077832 GGCCAAAGGGCTTCAGATCAGGG - Intronic
1104800260 12:131550186-131550208 GGCCAATTGATTTCCCATAACGG - Intergenic
1107083876 13:36405176-36405198 GGCCTTTGTCCTTCCCTTCAGGG + Intergenic
1107404179 13:40097548-40097570 GGCCAATGGCCTCTCCCACAGGG + Intergenic
1107552127 13:41487166-41487188 GGCCTGTGTCCTTCCCTTCAGGG + Intergenic
1108922619 13:55694054-55694076 GGCCTGTGTCCTTCCCTTCATGG - Intergenic
1108973321 13:56403422-56403444 GACCTATGTCCTTCCCTTCAGGG - Intergenic
1114506350 14:23217435-23217457 GGCCAAGGCCCTTCTCTTCAGGG - Intronic
1114688058 14:24553889-24553911 GGCCTATGTGCTTCCCTTCAGGG + Intergenic
1115821080 14:37212648-37212670 GGCCTATGTCCTTCCCTTCAGGG - Intronic
1116395894 14:44448438-44448460 GTCCAACCCCCTTCCCATCATGG + Intergenic
1116930662 14:50687948-50687970 GGCCTGTGTCCTTCCCTTCAGGG + Intergenic
1126183858 15:45811529-45811551 GGCCTATGTCTTTCCCTTCAGGG - Intergenic
1126517541 15:49553492-49553514 GGCCTGTGTCCTTCCCTTCAGGG + Intronic
1128891351 15:71334635-71334657 GGCCAAATGCCAGCCCATCAAGG + Intronic
1131959336 15:97772715-97772737 GGCCTGTGTCCTTCCCTTCAGGG + Intergenic
1132338111 15:101061621-101061643 GGCCTCTTGCCTTCACATCAGGG + Intronic
1133423065 16:5663922-5663944 GGGCAGTCGCCTTCCCTTCAGGG + Intergenic
1137891808 16:52170758-52170780 GGCCACAGGCCTTGCCCTCAAGG - Intergenic
1138120704 16:54398898-54398920 GCCCATTGACCTTCCCAGCAGGG - Intergenic
1138345206 16:56316332-56316354 GGACACTGGCCTGCCCACCAGGG + Intronic
1142145072 16:88489511-88489533 GGCCCGTGGCCTTCCCAGCTGGG + Intronic
1143395444 17:6591734-6591756 GGCCAGTGGCCAAACCATCAGGG + Intronic
1148045507 17:44741493-44741515 GGCCAAAGTCCTCCCCATCGGGG + Intronic
1149234978 17:54578750-54578772 GGCCTATGTTCTTCCCTTCATGG - Intergenic
1151270937 17:72995540-72995562 GGCAGATGGCCCTCCCAGCATGG + Intronic
1152301529 17:79497803-79497825 AGCCAATGGCCACCCCAGCAGGG + Intronic
1152447494 17:80354340-80354362 GGCCAACGGACTTCCCTTCCTGG + Intronic
1154230748 18:12553671-12553693 GGCCCTTGTCCTTCCCTTCAGGG - Intronic
1155533884 18:26795430-26795452 GGCCTGTGTCCTTTCCATCAGGG - Intergenic
1156025925 18:32655244-32655266 GGCCTGTGTCCTTCCCTTCAGGG + Intergenic
1157172923 18:45424496-45424518 GGCCCAGGGGCTTCCCATCAAGG + Intronic
1158431370 18:57390165-57390187 GGCCTGTGTCCTTCCCTTCAGGG - Intergenic
1161299126 19:3534429-3534451 TGACGATGGCCTCCCCATCAGGG - Exonic
1164457048 19:28417661-28417683 GGCCTTTGTCCTTCCCTTCAGGG + Intergenic
1164491159 19:28715255-28715277 GGCCTGTGTCCTTCCCTTCAGGG - Intergenic
1165026098 19:32962888-32962910 GTCCAACGGCCTTCCCAAGATGG + Intronic
1165678989 19:37757117-37757139 GGCCAATTGCTTACTCATCAAGG + Intronic
1166878561 19:45913345-45913367 GGCCATTGCCATTCCCATCCGGG + Exonic
1167730478 19:51250706-51250728 GGCCAATTTTCTTCCCAGCAAGG - Intronic
925103742 2:1271859-1271881 GGCTAATTGGCTTCTCATCAAGG + Intronic
927416093 2:22882118-22882140 GCCCAGTGTCCTTCCCATCAAGG + Intergenic
928783661 2:34854985-34855007 GGCCTATGTCCTTCCCTTCATGG - Intergenic
928862388 2:35874698-35874720 GGCCTATATCCTTCCCTTCAGGG + Intergenic
930159302 2:48137958-48137980 GGCCTATGTCCTTCCCTTCAGGG - Intergenic
931572348 2:63681615-63681637 GGCCTGTGTCCTTCCCTTCAAGG - Intronic
931637348 2:64352365-64352387 GGCCTGTGTCCTTCCCTTCAGGG - Intergenic
931645574 2:64418866-64418888 GGCGAGTGGCCTCACCATCAAGG - Intergenic
931754321 2:65358894-65358916 GGCCAAGGGCTTTCCTATCTGGG + Intronic
932219228 2:69987201-69987223 GGCCAATCGCCATCCCCTCCTGG + Intergenic
935356521 2:102206795-102206817 GGCCTGTGTCCCTCCCATCATGG + Intronic
937656805 2:124386230-124386252 GGCCAATGACCTTCACACAATGG - Intronic
940786273 2:157984810-157984832 GGCCTATGTCCTTCTCTTCAGGG + Intronic
943593746 2:189830600-189830622 AGCCAAAGTCCTTCCCTTCAAGG - Intronic
944385575 2:199160255-199160277 GACCAAAGCCCTTCCCATCTCGG - Intergenic
945210310 2:207375663-207375685 GGCCTGTGTCCTTCCCTTCAGGG - Intergenic
945925169 2:215796035-215796057 GCCCAATGGGCTTCCCTGCATGG - Intergenic
947437460 2:230084814-230084836 GTCCAGTGGCCTCTCCATCATGG - Intergenic
948270513 2:236670011-236670033 GGCCAATGGCAGCCCCAGCAGGG - Intergenic
1169587108 20:7097167-7097189 GGCCTGTGTCCTTCCCTTCAAGG - Intergenic
1169795053 20:9453153-9453175 GTCCAAGGGCATTCCCAACATGG - Intronic
1170864021 20:20137312-20137334 GGCCTATGTCCTTCCCTTAAGGG + Intronic
1171355624 20:24543481-24543503 GGTCAATGAACTTCCCATCCGGG - Exonic
1173876429 20:46375175-46375197 GGACCATTGACTTCCCATCAGGG + Intronic
1178640103 21:34338494-34338516 GGCCCAGTGCCTTCCCATCCTGG - Intergenic
1179822887 21:43947094-43947116 GGCCAGCAGCCTTCCCATCCTGG + Intronic
1180953792 22:19732340-19732362 GGCCACTGGGGTTCCCCTCAGGG - Intergenic
1183281528 22:36935167-36935189 GACCAATGCCCTTCCCAGCATGG + Intronic
1184258649 22:43301885-43301907 GGCTAAAGGCCGTCCCACCAAGG + Intronic
1184452749 22:44592596-44592618 GGCAAATTCCCTTCCCAACAGGG - Intergenic
1184711820 22:46254989-46255011 CTCCCATGGCCTTCCCACCAAGG + Intergenic
949745422 3:7286107-7286129 GGCAAATTTCCTTCCCATGAGGG - Intronic
950614367 3:14147319-14147341 GGCCAAAGGTCTGCTCATCAGGG - Exonic
951204453 3:19910532-19910554 GGCCTGTGTCCTTCCCTTCAGGG - Intronic
951904383 3:27689189-27689211 GGCCTCTGTCCTTCCCCTCAGGG - Intergenic
954456926 3:50604682-50604704 GGCCACTGGCCTGGCCACCAAGG - Intergenic
954788616 3:53114016-53114038 GCCCAATTTCCTTCTCATCAGGG - Intronic
957154900 3:76534882-76534904 AGCCCATTTCCTTCCCATCATGG - Intronic
957621993 3:82605135-82605157 AGCCTATGTCCTTCCCATCAGGG - Intergenic
959414103 3:106062346-106062368 GGCCTGTGTCCTTCCCTTCAGGG - Intergenic
962688453 3:137869360-137869382 GGCCTGTGTCCTTCCCTTCAGGG - Intergenic
966979916 3:185122598-185122620 GGCTTATGGACTTCCCATTAGGG + Intronic
967983170 3:195077669-195077691 GGTCAGAGGCCTTGCCATCAGGG - Intronic
970310469 4:14777328-14777350 GGGCAATGGCCTCCCCTACATGG - Intergenic
970866227 4:20761974-20761996 AGTCAAAGGTCTTCCCATCATGG + Intronic
971395988 4:26227978-26228000 GACCAATGGCTTGCGCATCACGG - Intronic
972104076 4:35461187-35461209 GGCCTATGTCCTTCCCTTCAAGG + Intergenic
972560278 4:40221203-40221225 GGCCAATGTCCTTCTCGGCAAGG + Intronic
972874849 4:43345747-43345769 GGCTAATGGCCTTCTCACTAAGG + Intergenic
972909620 4:43798014-43798036 GGCCTGTGTCCTTCCCTTCAGGG - Intergenic
974593187 4:63982900-63982922 CACCCATGTCCTTCCCATCAAGG + Intergenic
974597161 4:64029646-64029668 GGCCTATATCCTTCCCTTCATGG + Intergenic
974630258 4:64479709-64479731 GGCCTGTGTCCTTCCCTTCAGGG + Intergenic
975480172 4:74869814-74869836 GGCCACGGGCCTTCCATTCATGG + Intergenic
975629859 4:76388667-76388689 GTCCAAGGTCCTTCCCTTCAGGG - Intronic
976982147 4:91244345-91244367 GCCCAAGGCCCTTCCCTTCAAGG - Intronic
979396814 4:120198466-120198488 GTCCAAGGCCCTTCCCTTCAGGG - Intergenic
979682945 4:123481466-123481488 GCTGAGTGGCCTTCCCATCATGG - Intergenic
981551456 4:145945709-145945731 GGCCCATGGACCTGCCATCAGGG - Intergenic
981895731 4:149796492-149796514 GGCCTATGTCCTTCCCTTCAGGG - Intergenic
981996229 4:150977966-150977988 GGCTTATGTCCTTCCCTTCAGGG - Intronic
985899839 5:2779922-2779944 GGGCCATGGCCCTGCCATCAAGG - Intergenic
986544470 5:8880340-8880362 GGACAAGGTCCTTCCCTTCAAGG + Intergenic
989171220 5:38471825-38471847 AGCTTATGGCCTTGCCATCAGGG - Intergenic
989629053 5:43461868-43461890 GGCCTATGTCCTTCCTTTCAGGG - Intronic
992291460 5:75283837-75283859 GGCTTATGTCCTTCCCTTCAGGG - Intergenic
993582379 5:89678170-89678192 GGCCTATGTCTTTCCCTTCAGGG - Intergenic
995278495 5:110306841-110306863 GGCCTGTGCCCTTCCCTTCAGGG + Intronic
995395044 5:111678490-111678512 GACCACTGGGCTTCCCAACACGG - Intronic
995777898 5:115745483-115745505 GGCCTGTGTCCTTCCCTTCAGGG + Intergenic
996161703 5:120174271-120174293 GGGCTATGTCCTTCCCTTCATGG - Intergenic
996172085 5:120306114-120306136 AGACAATGTCTTTCCCATCAGGG - Intergenic
996359964 5:122635164-122635186 GTCTAATGGGCTTCCCTTCATGG + Intergenic
996594568 5:125185798-125185820 GGCCTGTGTCCTTCCCTTCAGGG - Intergenic
997210230 5:132072914-132072936 GGACAATGGCTTCCCCAGCAAGG - Intergenic
997708303 5:135979691-135979713 GGACAACGGCATTACCATCAGGG + Intergenic
998058241 5:139097284-139097306 GGCCCATATCCTTCCCTTCAGGG - Intronic
998716486 5:144890002-144890024 GGCCTTTGTCCTTCCCCTCAGGG - Intergenic
1005279999 6:24262802-24262824 GACCCATGTCCTTCCCTTCAAGG - Intronic
1006396259 6:33789209-33789231 GGCGACCGACCTTCCCATCATGG - Intergenic
1006963814 6:37961434-37961456 GACCTATGTCCTTCCCTTCAGGG - Intronic
1008177536 6:48287668-48287690 GGCCTGTGCCCTTCCCTTCAGGG + Intergenic
1008312241 6:49990293-49990315 GGCCTATGTCCTTCCCTTCAGGG - Intergenic
1008880844 6:56378657-56378679 GGCCCATGTCCTTCCCTTAAGGG - Intronic
1010328146 6:74588506-74588528 GGCCTGTGTCCTTCCCTTCAGGG - Intergenic
1010528974 6:76942678-76942700 GGCCTATGTCCTTTCCTTCAGGG - Intergenic
1012224580 6:96689225-96689247 GGCTTATGTCCTTCCCTTCATGG - Intergenic
1014583122 6:123162366-123162388 GGCCTATGTCCTTTCCTTCAGGG - Intergenic
1019360675 7:602738-602760 GGCCAATGGCTTCCACACCAGGG + Intronic
1021114389 7:16731529-16731551 TCACAATGGCCTTGCCATCAGGG - Intergenic
1021203428 7:17752469-17752491 GGCCTGTGGCCTTCCCTTCTGGG + Intergenic
1022898411 7:34776792-34776814 GGACTATGTCCTTCCCTTCAAGG + Intronic
1023115297 7:36856282-36856304 GGCCAATGGCAGTCCCACCTTGG + Intronic
1024222096 7:47297124-47297146 GGCCTATGGCCTGGCCATGAAGG - Exonic
1026849541 7:73716402-73716424 GGCCCTGGGCCTTCCCATCCAGG + Intronic
1027524155 7:79245712-79245734 GGCTCATGTCCTTCCCTTCAGGG - Intronic
1028073329 7:86479265-86479287 GGCACATGGCCTTTCCAGCATGG - Intergenic
1028972683 7:96876037-96876059 GGCTCATGCCCTTCCCTTCAGGG - Intergenic
1030598960 7:111571154-111571176 GGCCTGTGTCCTTCCCTTCAGGG - Intergenic
1032939207 7:136768796-136768818 GACCAAGGCCCTTCCCTTCAAGG - Intergenic
1033691413 7:143740859-143740881 GGCCTATGCCCTTCCCTTCAGGG - Intergenic
1034018972 7:147619759-147619781 GGCCTATGTCCTTCCCTTCAGGG - Intronic
1034345489 7:150382876-150382898 CACCCATGGCCATCCCATCAGGG - Intronic
1039241478 8:35561337-35561359 GGCCAAGGGCCTTTCCATTGTGG - Intronic
1039531193 8:38264567-38264589 GGCAAATGTCATTCCAATCATGG + Exonic
1042726794 8:71887981-71888003 GGCCTGTGTCCTTCCCTTCAGGG + Intronic
1042898463 8:73695952-73695974 GCCCAAGGCCCTTCCCTTCAGGG - Intronic
1044509280 8:93056874-93056896 GTCCAATGGGCTTCCCATTGTGG + Intergenic
1045554356 8:103201217-103201239 GGCCAAGGCCCTGCCCATCATGG - Intronic
1051438944 9:17062421-17062443 GGCCAGGGGGCCTCCCATCATGG + Intergenic
1051704403 9:19861015-19861037 GGCCTATCTCCTTCCCTTCAGGG - Intergenic
1051921842 9:22275500-22275522 GGCCTGTGTCCTTCCCTTCAGGG - Intergenic
1055339171 9:75263362-75263384 GGCCTATGTCCTTCCCTTTAGGG + Intergenic
1055958175 9:81793892-81793914 GGGCAATGACCATCCCAGCACGG - Intergenic
1056490164 9:87098398-87098420 AGCCACTGCCCTTGCCATCAGGG + Intergenic
1058961088 9:109993619-109993641 GGCCTTTGGCCCTCCCAACACGG - Intronic
1060231842 9:121831150-121831172 GGAAACTGGCCTTCCCCTCAAGG + Intronic
1060328790 9:122644539-122644561 TGCCAAGGGCCTTCCCTTCAGGG - Intergenic
1060398450 9:123332920-123332942 GTCCAGTGTTCTTCCCATCAAGG + Intergenic
1185724913 X:2411893-2411915 GGAAAATGGCCTGCCCATGAAGG - Intronic
1185791004 X:2928476-2928498 GGCCCTTTGCCTTCCCAGCACGG - Intronic
1187363734 X:18650189-18650211 GGCCAATGGCCTTGACAGCCTGG + Intronic
1187623657 X:21086417-21086439 GGCTTATGTCCTTCCCTTCAGGG - Intergenic
1188363072 X:29280816-29280838 GGCCTTTTGCCTTCCCATCCTGG - Intronic
1189769982 X:44416258-44416280 GGCCTATGTTCTTCCCTTCAAGG + Intergenic
1189858370 X:45247312-45247334 GGCCAATGTCCTTCCTATCAGGG + Intergenic
1190049990 X:47142367-47142389 GGCCAATGGCCTTCCCATCATGG - Exonic
1190907810 X:54745940-54745962 GGCTTATGTCCTTCCCTTCAGGG + Intergenic
1191119073 X:56884461-56884483 GCCCAAGGCCCTTCCCTTCAGGG + Intergenic
1191829653 X:65402396-65402418 GGCCTGTGTCCTTCCCTTCAGGG - Intronic
1192104853 X:68305395-68305417 GGACAATGGCCTGCCCATGGGGG + Intronic
1192505563 X:71680084-71680106 GGCCTTTGTCCTTCCCTTCAGGG + Intergenic
1192812644 X:74560537-74560559 GGCCTATGTCCTTTCCTTCAGGG - Intergenic
1193876507 X:86868775-86868797 GGCCCATGGCCTTCCCTTCAGGG + Intergenic
1194218834 X:91167088-91167110 GGCCATTCTCCTTCCCTTCATGG + Intergenic
1194290994 X:92071897-92071919 TGCCCATGGCCTTCTCTTCAGGG + Intronic
1194396631 X:93394790-93394812 GACCAATGTCCTTTCCTTCAGGG + Intergenic
1194780712 X:98022730-98022752 GACCAAGGCCCTTCCCTTCATGG + Intergenic
1194928891 X:99862612-99862634 GGCCTATGTCCTTCCCTTCAGGG - Intergenic
1195224954 X:102783775-102783797 GGCCCATGTCCTTCCCTTCAGGG + Intergenic
1195595534 X:106683920-106683942 GGCTTATGTCCTTCCCTTCAGGG - Intergenic
1195834815 X:109102495-109102517 GGCCTATATCCTTCCCTTCATGG + Intergenic
1195971427 X:110477851-110477873 GGCCTGTGTCCTTCCCTTCAGGG + Intergenic
1196066690 X:111471688-111471710 GGCCTCAGTCCTTCCCATCACGG - Intergenic
1196190660 X:112790932-112790954 GGCCACAGGACTTCCTATCATGG + Intronic
1196247470 X:113416183-113416205 GGCCTATGTCCTTCCCTTCAGGG - Intergenic
1196357210 X:114809061-114809083 GGCCTGTGTCCTTCCCTTCAGGG + Intronic
1196479854 X:116135569-116135591 GGCTTGTGTCCTTCCCATCAAGG + Intergenic
1196625423 X:117871902-117871924 GGCCTGTGCCCTTCCCTTCAGGG - Intergenic
1197068606 X:122266440-122266462 GGCCTATGTCCTTCCCATGATGG + Intergenic
1197465528 X:126799830-126799852 GGCCTATGCCCTTCCCTTCAGGG - Intergenic
1197715094 X:129700857-129700879 GGCCAAGGGCCATCCCACCATGG - Intergenic
1199144752 X:144351426-144351448 GGCCTGTGTCCTTCCCTTCAGGG + Intergenic
1199148380 X:144397937-144397959 GGCTTATGTCCTTCCCTTCAGGG - Intergenic
1199156214 X:144551608-144551630 GGCCTGTGTCCTTCCCTTCAGGG - Intergenic
1199374161 X:147087951-147087973 GGCCTGTGTCCTTCCCTTCAGGG + Intergenic
1200370617 X:155720378-155720400 GGCCTGTGTCCTTCCCTTCAAGG - Intergenic
1200555343 Y:4630842-4630864 GGCCATTCTCCTTCCCTTCATGG + Intergenic
1200608503 Y:5296472-5296494 TGCCCATGGCCTTCTCTTCAGGG + Intronic