ID: 1190051527

View in Genome Browser
Species Human (GRCh38)
Location X:47153760-47153782
Sequence TGTACCTCGAAAAACTTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 44}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190051524_1190051527 23 Left 1190051524 X:47153714-47153736 CCTTTGTTATTCTCTCTTTATTG 0: 1
1: 0
2: 5
3: 67
4: 670
Right 1190051527 X:47153760-47153782 TGTACCTCGAAAAACTTGGTAGG 0: 1
1: 0
2: 0
3: 7
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190051527 Original CRISPR TGTACCTCGAAAAACTTGGT AGG Intronic
906046702 1:42836557-42836579 TGTGCTTTGAAAAACTTGGCCGG + Intronic
909823903 1:80100913-80100935 TGTATCTCTAAACACTTGTTAGG - Intergenic
911834709 1:102602422-102602444 TGTACTTAGAAAAATTTGGAAGG - Intergenic
916210745 1:162357762-162357784 TGTACCCCAAAAAACTTGTTCGG + Intronic
1063903840 10:10762974-10762996 TGTAGCTCTAAAAATGTGGTTGG - Intergenic
1068991184 10:63152681-63152703 TGTATCTTGAAACACTTGGCAGG - Intronic
1074569687 10:114613246-114613268 TGTACTTCGAAAATCTTGAGGGG + Intronic
1079384943 11:19970502-19970524 TATACCAAGAAACACTTGGTAGG + Intronic
1080034637 11:27699586-27699608 TGTAGCTTGGAAAACTTGGGAGG - Intronic
1086494260 11:87386097-87386119 TGTATCTTGAAGAATTTGGTTGG - Intergenic
1087034102 11:93739097-93739119 TGTAACTAGATAAACTTGGAAGG + Intronic
1087866481 11:103233793-103233815 TCTACCTCAAAAAACTTGACAGG - Intronic
1097416113 12:59318417-59318439 TGAACCTTTAAAAACTCGGTTGG - Intergenic
1098303514 12:69078620-69078642 TATACCTCAATAAACTTGGTAGG + Intergenic
1108285891 13:48907531-48907553 TGTCCCTCAAAGAATTTGGTGGG - Intergenic
1111070675 13:83161817-83161839 TGTACTTATAAAAACCTGGTGGG - Intergenic
1115048911 14:29032070-29032092 CATACCTCCATAAACTTGGTGGG - Intergenic
1115898783 14:38121145-38121167 TGTTCCTCAAAAAACTTTCTAGG - Intergenic
1123541993 15:21301917-21301939 TGTATCTCAGAAAAGTTGGTTGG - Intergenic
1127562896 15:60158058-60158080 AGTACCTCAAAGAACTTAGTGGG + Intergenic
1135920513 16:26645057-26645079 AGTATCTCGAACCACTTGGTAGG + Intergenic
1143003277 17:3809360-3809382 TGTCCCTGCAAAAACTTGTTCGG + Intergenic
1146360113 17:32167749-32167771 TCTACATCGAAAATCTTGGTTGG + Intronic
929700893 2:44162089-44162111 TGAACCTTAAAAAAATTGGTGGG + Intergenic
941416665 2:165229763-165229785 TGTAACTAGAAGAACTTGATAGG + Intergenic
943527550 2:189036678-189036700 TGTACCACGTAAAACCTGGTGGG - Exonic
1182049621 22:27302747-27302769 TGTACCTCCTAAAACCTGGTGGG + Intergenic
949595101 3:5535118-5535140 TGTACCAAGAAAATCTTGCTTGG + Intergenic
950388713 3:12679462-12679484 TGTACCTCTATAACCTTGTTTGG - Intergenic
952157870 3:30663089-30663111 TGTACCTTTAAAAATTTTGTTGG - Intronic
960496268 3:118378862-118378884 TGTACTCCGAACAACATGGTAGG + Intergenic
960837120 3:121918288-121918310 TGAACCTTGAACAACTGGGTAGG + Intronic
963803030 3:149696307-149696329 TGTACCTGGAAAGACATGCTTGG + Intronic
970094547 4:12447952-12447974 TATAACTAGAAACACTTGGTTGG + Intergenic
971128779 4:23782771-23782793 GGTACCTTGAAAAACTTTGTGGG - Intronic
972922486 4:43960962-43960984 TGTACATAGAAAAAATAGGTGGG - Intergenic
975680801 4:76874119-76874141 GGCACCTCTACAAACTTGGTGGG + Intergenic
978062560 4:104355569-104355591 TGCACCTTAAAAAACTAGGTTGG + Intergenic
980277667 4:130676169-130676191 TGTTCCTCAAAAGACATGGTTGG - Intergenic
988466338 5:31496009-31496031 TGCAGCTGGAAACACTTGGTTGG + Intronic
996306550 5:122053851-122053873 TGTACCAGGAAACACTTGGGTGG - Intronic
1012021110 6:93920751-93920773 TGTACTTCGAAAAATTTAGCAGG + Intergenic
1036491825 8:9234031-9234053 TGTATCTCCAATAACCTGGTTGG + Intergenic
1045175923 8:99724791-99724813 TGTTCCTCTAAAAACTTAGAAGG - Intronic
1055132485 9:72792313-72792335 TGTACCTCGAGGACCTTGCTGGG + Exonic
1055144753 9:72919936-72919958 TCTATCTCTAAAAACTTGGCTGG + Intronic
1186272266 X:7901613-7901635 TTTACATCAATAAACTTGGTAGG - Intronic
1188223563 X:27570134-27570156 TGCACCTCCAGAAACTTGGTAGG + Intergenic
1190051527 X:47153760-47153782 TGTACCTCGAAAAACTTGGTAGG + Intronic
1190427119 X:50344219-50344241 TGTACCTCCAAAAACCTAGATGG - Intronic
1194740387 X:97565782-97565804 TGTATCTCTAAAAACTTAGGTGG - Intronic
1198691346 X:139288185-139288207 TGTAGCTCCAGAAACTTGGGAGG + Intergenic