ID: 1190052358

View in Genome Browser
Species Human (GRCh38)
Location X:47159735-47159757
Sequence ATCCCAGCACTTATTGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 194}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190052358_1190052363 11 Left 1190052358 X:47159735-47159757 CCCTGTTCAATAAGTGCTGGGAT 0: 1
1: 0
2: 1
3: 17
4: 194
Right 1190052363 X:47159769-47159791 CATATTCAGAAGAATGAAACCGG 0: 12
1: 495
2: 1860
3: 6131
4: 7011

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190052358 Original CRISPR ATCCCAGCACTTATTGAACA GGG (reversed) Intronic
900643750 1:3699424-3699446 ACCCCAGCTCTTGTAGAACAAGG - Intronic
900718200 1:4158471-4158493 ATCCCAGCACTTAGGGAGAAGGG + Intergenic
903133845 1:21296631-21296653 ATCCCAGGACTTATCCCACATGG - Intronic
910901799 1:92129235-92129257 ATCCCAGCACTTCAGGAATAGGG + Intronic
911750400 1:101490090-101490112 ACCACAGCATTTATTGAACAGGG + Intergenic
912333397 1:108840741-108840763 GTCCCACCACTTATTGAATAGGG - Intronic
912939715 1:114034048-114034070 TACCCAGCACCTATTCAACATGG - Intergenic
914327797 1:146637319-146637341 CTCCAAGCATTTATTGAACTCGG + Intergenic
919128594 1:193426695-193426717 ATCCCAGCACTTTGGGATCAAGG - Intergenic
919893937 1:201996742-201996764 ATCCCAGCACTTTGGGACCAAGG - Intronic
921378379 1:214498339-214498361 ATTCCAGCTCTTATTGACCTGGG - Intronic
921390736 1:214610914-214610936 ATCTCATCATTTATTGAATAGGG + Intronic
921540583 1:216409639-216409661 ATCCCAACATTTATTGAATAGGG - Intronic
923785054 1:237058662-237058684 ATCCCAGCACTTTTGGAGCCAGG + Intronic
1063083587 10:2791865-2791887 ATCCCAACACTTTTTGAAGATGG - Intergenic
1063486879 10:6428513-6428535 TGCCCAGCTCTCATTGAACATGG + Intronic
1064703302 10:18044717-18044739 ATCCCAGGAATTATTGAATTAGG + Intergenic
1065829967 10:29606159-29606181 ATCCCAGCACTTAGGGGCCAAGG - Intronic
1067367335 10:45645218-45645240 ATCCCAGCACTTTTGGAAGGTGG - Intronic
1070143639 10:73757675-73757697 ATCCCAGCACTTTGTGAAGCCGG + Intronic
1071577576 10:86740691-86740713 ATCCCAGCATTTGTGGAAGAAGG + Intergenic
1071832466 10:89385392-89385414 ATCCCTGCATTCATTGACCAAGG + Intronic
1077377676 11:2212870-2212892 ATCCCAGCTCCTGTTGAGCATGG + Intergenic
1079058261 11:17226221-17226243 ATCCCAGCACTTTGGGAACCCGG + Intronic
1080654030 11:34244578-34244600 AGCCCAGCTCTTATTCACCATGG - Intronic
1080995286 11:37592280-37592302 ATCCCAACACTTCTTGTAAATGG - Intergenic
1084096574 11:66915375-66915397 ATCACAGCTATAATTGAACAGGG + Intronic
1084942826 11:72622938-72622960 ATCCCAGCAACTGTTGAACTGGG + Intronic
1085693439 11:78683959-78683981 AAGCCAGCACTTACTGAAGACGG - Intronic
1086741343 11:90373222-90373244 ATCTTAATACTTATTGAACAAGG + Intergenic
1087304673 11:96474432-96474454 TTCCCAGCACCTATTCAACATGG - Intronic
1087495305 11:98883627-98883649 ATCAGAGCATTTATTGAATAGGG - Intergenic
1090472774 11:126995207-126995229 ATCCCAGCACTCTTGGAGCAGGG - Intronic
1091035952 11:132233749-132233771 ATCCCTGCACTGCATGAACATGG + Intronic
1091954084 12:4622539-4622561 ATCCCAGCACCTATTGAATTAGG - Intronic
1092271022 12:7023501-7023523 ATGCCACCATTTTTTGAACATGG + Intronic
1093954859 12:25204193-25204215 ATCAAAGAACTTATTGCACAGGG + Exonic
1099346510 12:81506925-81506947 ATACCAGCACTTCTTAAACATGG + Intronic
1099438204 12:82668593-82668615 ATCCCAGCACTTTTTGAGGCAGG - Intergenic
1100281176 12:93119825-93119847 ATCCTAGCATTTATTTGACAAGG - Intergenic
1102306071 12:111805573-111805595 ATCCCAGCACTTTGGGACCAAGG - Intronic
1103616176 12:122154064-122154086 ATCCCAGCACTTTGGGATCAAGG - Intergenic
1103832174 12:123788673-123788695 ATCCCAGCACTTTTTGAGGCTGG + Intronic
1105730133 13:23205480-23205502 AGCCCAGCACGTGCTGAACAAGG + Intronic
1105776119 13:23662264-23662286 ATCCCAGGATTTATTGAACAGGG + Intronic
1105999081 13:25702711-25702733 AACCCAGCCCTTAGTGAAGAAGG + Intronic
1110861614 13:80350418-80350440 ATCCCAGCACTAATTTTAAATGG + Intergenic
1112839256 13:103555581-103555603 ATCCCAGCACTTAGGGAAGCTGG + Intergenic
1114286005 14:21244250-21244272 ATCCCTGCACTTTTGGAACGTGG - Intronic
1116026263 14:39519135-39519157 ATCCCGCCATTTATTGAATAAGG - Intergenic
1117311163 14:54524643-54524665 ATCCCAGCACTTTGTGAGCCTGG - Intronic
1117461564 14:55950524-55950546 ATCCCAGCACTTTGTGGCCAGGG + Intergenic
1118113414 14:62748504-62748526 TTCCCAGCCCTTATTCAAGATGG + Intronic
1118355451 14:65009849-65009871 ATCACAGCGTTTATTGGACAGGG + Intronic
1120359161 14:83474861-83474883 ATCCCAGCACTTTTTAAATTTGG + Intergenic
1121762727 14:96459627-96459649 ATCCCAGCACTTCGTGATCTAGG + Intronic
1126177172 15:45746652-45746674 ATCCCTGCACATCTTCAACATGG + Intergenic
1127453917 15:59140988-59141010 AAGCAAGCACTTCTTGAACAGGG - Intronic
1127629602 15:60814729-60814751 ATCACAGCACTGGTTGAAAATGG - Intronic
1132578894 16:676220-676242 CTCCCAGCACTTTTGGGACAGGG - Intronic
1132654945 16:1037830-1037852 CTCCCAGCACTGATGGAAGAGGG + Intergenic
1133478227 16:6144194-6144216 ATCCCAGCACTTATAGTCCATGG - Intronic
1134818016 16:17222233-17222255 AAGCCAGCACTTCTTGACCAGGG + Intronic
1135231765 16:20715349-20715371 ATCCCAGCACTTTTGGATCCTGG + Intronic
1135961092 16:26995109-26995131 ATCCCAGCACTTTGGGAGCAAGG + Intergenic
1138959762 16:62014944-62014966 ATCACAGGACTTACAGAACAAGG + Intronic
1139066097 16:63316820-63316842 ATCCCAGCACTTAGAGACCTAGG + Intergenic
1140005762 16:71073618-71073640 CTCCAAGCATTTATTGAACTCGG - Intronic
1140753088 16:78043871-78043893 ATCCCAGCACTTATGGGAGCTGG + Intronic
1141309588 16:82900412-82900434 ATCCCTGTACTTCTTGAACCAGG - Intronic
1141413135 16:83849878-83849900 ATCCCAGCACTTTGGGAAAATGG + Intergenic
1144821387 17:18077032-18077054 GCCCCAGCCCTTATGGAACACGG - Intergenic
1146656039 17:34635907-34635929 ATCCCAGCACTGCTGGAAGAGGG - Intronic
1147282009 17:39369884-39369906 ATCCCAGCACTTTTGGAGGAGGG - Intronic
1148626985 17:49077039-49077061 TACCCAGCACTTATTCAAGATGG + Intergenic
1148764959 17:50032825-50032847 ATCCCAGCACTTTGGGAGCAAGG + Intergenic
1148768735 17:50055053-50055075 ATCCCAGCACTTTGGGAACCCGG - Intergenic
1148885844 17:50772097-50772119 ATGCCACCATTTTTTGAACATGG + Intergenic
1150508226 17:65720707-65720729 ATCTCAACACTTATTGAATAGGG + Intronic
1150556889 17:66262661-66262683 GTCCCAGCACTTAGTTACCAGGG - Intergenic
1150722368 17:67624449-67624471 ATCCCAGCACTTTGTGAGGATGG - Intronic
1151385246 17:73751280-73751302 TTCCCAGCCTTTCTTGAACATGG - Intergenic
1153989925 18:10387333-10387355 ATTCCAACACTCACTGAACAAGG + Intergenic
1156592170 18:38503004-38503026 AACTCAGCACTTATTGAGCAAGG - Intergenic
1159042206 18:63334889-63334911 ATCCCAGTACTTTTTAAGCAAGG + Intronic
1159117371 18:64130804-64130826 AAACAAGCAATTATTGAACAAGG - Intergenic
1159145021 18:64443058-64443080 ATGACAGCACTTACTGAAGAGGG - Intergenic
1159171366 18:64772466-64772488 ATTCCTGCACTTACAGAACAAGG - Intergenic
1161188390 19:2938584-2938606 ATCCCAACACCCATGGAACATGG - Intronic
1164199626 19:23005902-23005924 ATGCCAGCATTTATTGAATTGGG + Intergenic
1164285737 19:23815094-23815116 ATCCCAACACTTAGAGATCAAGG - Intronic
1164985058 19:32642485-32642507 ATCCCAGCACTTGTAAACCAGGG + Intronic
1165133520 19:33648620-33648642 ATCCCAGCACTCTTGGAAAACGG + Intronic
1165636448 19:37344296-37344318 AGCCCAGCAATGTTTGAACAAGG - Intronic
1166058675 19:40310530-40310552 ATCCCAGCACTTTTGGAAGGCGG - Intergenic
1167233356 19:48298678-48298700 ATCTCAGCAATTTTTTAACAAGG + Intronic
1168278891 19:55293241-55293263 ATCCCAGGACTTCTTGAACCCGG + Intronic
926058647 2:9791725-9791747 ATCCAAGTACTTATATAACAAGG + Intergenic
928277748 2:29918533-29918555 ATTCCAGCACTAAATGAAAAGGG + Intronic
929018644 2:37527704-37527726 ATCTCACCACTTTTTGAATATGG - Intergenic
935471830 2:103469993-103470015 TACCCAGCACTTATTCAAGATGG + Intergenic
937197648 2:120173929-120173951 ATCCCAGCACTTAGTGAGGTGGG - Intronic
939156072 2:138525563-138525585 ATCCCAGCACTTTGTGAGCCAGG + Intronic
942719603 2:178936329-178936351 ATTCCAGCATTTATTGAATAGGG + Intronic
943221279 2:185109602-185109624 TTAGCACCACTTATTGAACAGGG - Intergenic
943589396 2:189779222-189779244 ATCCCAGCACTTTTGGAGGATGG + Intronic
944453126 2:199864010-199864032 ATTCCAGGGATTATTGAACATGG - Intergenic
946426429 2:219600349-219600371 ATCCCAGCACTTTGGGAGCAAGG - Intronic
948535866 2:238646329-238646351 ATCCCATCACTTTTGGACCATGG - Intergenic
1168890135 20:1289949-1289971 ATCCCAGCACTTTGGGAGCAGGG + Intronic
1169024222 20:2353936-2353958 ATACAAACACTTATTGATCAAGG + Intergenic
1169410356 20:5364126-5364148 ATGCCACCATTTTTTGAACAGGG - Intergenic
1178416218 21:32407152-32407174 ATCCCAGCACTTTTAGGCCAAGG - Intergenic
1180660873 22:17465963-17465985 CTCAGAGCATTTATTGAACATGG + Intronic
1180795324 22:18601171-18601193 ATCCCAGCAGTTTTGGAGCAAGG + Intergenic
1181226416 22:21394141-21394163 ATCCCAGCAGTTTTGGAGCAAGG - Intergenic
1181252234 22:21540697-21540719 ATCCCAGCAGTTTTGGAGCAAGG + Intergenic
1181328223 22:22067949-22067971 ATCCCTGTACATATTGAAAAGGG + Intergenic
1184020425 22:41817479-41817501 ATCCCAGCACTTAGGGACCGAGG + Intronic
951201634 3:19881669-19881691 ATCCCAGCAATTCTTTCACACGG - Intronic
953099806 3:39812930-39812952 ATCCCAGCTCTTTATGAAGATGG + Intronic
954218169 3:49135893-49135915 ATCACAGCAGTCATTGAACAAGG + Intergenic
956221425 3:66907894-66907916 AGCCCATCACTTATAGAGCAAGG - Intergenic
956904627 3:73753005-73753027 CTCCCAGAGCTCATTGAACAAGG - Intergenic
957160117 3:76600274-76600296 ATCCCAGCATTTACTAAATAGGG + Intronic
958962499 3:100523402-100523424 TACCCAGCATTTATTGAATAGGG - Intronic
963428888 3:145170429-145170451 TTCTCAGTACTTATTGTACAAGG - Intergenic
964718991 3:159753101-159753123 ATTCTAGCACTTATAGAACTAGG - Intronic
965906615 3:173715421-173715443 CACCCATCACTTATGGAACAAGG - Intronic
968674039 4:1867581-1867603 ATCCCAGCACTTTGGGACCAAGG - Intergenic
969272684 4:6113452-6113474 ATCCCAGCAATTCTGGAGCAGGG + Intronic
970634129 4:17988732-17988754 ATCCCAGCACTTTGGGATCAAGG + Intronic
972311034 4:37882639-37882661 ATCCCAGGAATGATTGAAGATGG + Intergenic
973068768 4:45831190-45831212 ATCCCACCATTTATTGAAAAGGG + Intergenic
973567831 4:52206221-52206243 ATGCCAGCACTTTTGGAGCATGG + Intergenic
974550350 4:63364098-63364120 ATCCCAGCACTTTGGGACCAAGG - Intergenic
974591077 4:63949305-63949327 TTCCCACCATTTATTAAACAGGG + Intergenic
978192620 4:105932622-105932644 ATCCCAGCTCCTCTTGACCAAGG + Exonic
978800588 4:112752008-112752030 TTCCCAGGACTTATTAACCAAGG + Intergenic
979084887 4:116395580-116395602 TACCCAGCCCTTATTGAATATGG + Intergenic
983902119 4:173146725-173146747 ATCCCAGCACTTTGAGACCAAGG - Intergenic
984741484 4:183168104-183168126 ATCCCAGCACTTTGGGACCAAGG - Intronic
985587612 5:748994-749016 ACCCCAGCACTTAGTGAGGAAGG - Intronic
986861987 5:11937092-11937114 ATGCCACCATTTTTTGAACATGG + Intergenic
989237808 5:39169737-39169759 ATCCCAACACCTAATGAAGATGG - Intronic
989642874 5:43600281-43600303 ATCCCAGCACTTTGTGGCCAAGG - Intergenic
990155520 5:52872723-52872745 AGCACAGCACTTCATGAACAAGG - Intronic
990770216 5:59235400-59235422 ATCCCATCACTTATTGCCCAGGG - Intronic
991392621 5:66163901-66163923 ATCTCAGCAGCTATTGAACCAGG + Exonic
991690716 5:69222646-69222668 ATCCCAGCACTTTGGGAAGACGG - Intronic
991718597 5:69475348-69475370 ATCCCAGCACTTTGGGAACCGGG + Intergenic
991895227 5:71388786-71388808 ATGCCAGCTCTCCTTGAACATGG - Intergenic
992635424 5:78721775-78721797 ATCCCAACACTAATTGCATAAGG + Intronic
992970519 5:82052036-82052058 ATGCCAGCACTGATCAAACAAGG - Intronic
994005562 5:94833162-94833184 ATACCAGAACTTATTGAATCAGG + Intronic
995408695 5:111830960-111830982 CTTCCATCACTTATGGAACAGGG - Intronic
998421031 5:141986892-141986914 ATGCCACCATTTTTTGAACATGG - Intronic
998650590 5:144117167-144117189 ACCCCAGCTCTTATCAAACATGG + Intergenic
1000689663 5:164300680-164300702 ATCCCAGCACTCCTTGAAGTAGG - Intergenic
1001308752 5:170595338-170595360 ATCCCACCACTGATGGAACTGGG - Intronic
1002069975 5:176673446-176673468 ATCCCAGCACTTTGGGAAGATGG - Intergenic
1004031071 6:11870061-11870083 ATGGCATCATTTATTGAACATGG - Intergenic
1004328158 6:14696064-14696086 ATCCCAGCAGGAATTGAACCTGG + Intergenic
1006596077 6:35193233-35193255 ATCTCCCCACTTATTGAAAATGG - Intergenic
1008299049 6:49811701-49811723 ATCCCAGCACTTTTGGAAGCTGG - Intergenic
1009189356 6:60611163-60611185 CTCCCAGCATTTATTAAATAGGG + Intergenic
1010537657 6:77050892-77050914 TTCCCAACACTTATTAAATAGGG - Intergenic
1017194333 6:151683962-151683984 ATCCCAGCACTTTTTGAGGCAGG - Intronic
1017196089 6:151701946-151701968 AGCACAGCACTTCTTGAAAAAGG + Exonic
1021408974 7:20306579-20306601 AAACCATCACTTGTTGAACAGGG + Intergenic
1022028291 7:26468617-26468639 TTCCCAGCACCTCTTAAACACGG + Intergenic
1022712193 7:32862515-32862537 GTCCCTGCACTTATCGCACAGGG - Intergenic
1024170105 7:46776445-46776467 ATCCCTGCCCTCATGGAACAAGG - Intergenic
1031173503 7:118320381-118320403 TACCCAGCACCTATTGAAGATGG + Intergenic
1031182777 7:118437750-118437772 ATCGCAGCAGTTCTTCAACAGGG + Intergenic
1034881229 7:154764106-154764128 ATCCCAGCAATGCTTTAACAAGG - Intronic
1035097745 7:156369203-156369225 ATCCCAGCACTCAATGAATCAGG + Intergenic
1035177189 7:157059834-157059856 CTCCCTGCACTTATTAAACGTGG + Intergenic
1035309044 7:157953223-157953245 AGCTCATCACATATTGAACACGG - Intronic
1036113961 8:5937532-5937554 CTCCCAGCATTTATTACACAGGG - Intergenic
1036476668 8:9099347-9099369 ATCCCAGCACTTAGGGAGCCAGG + Intronic
1037842277 8:22253515-22253537 ATTGCAGCATTTTTTGAACATGG - Exonic
1039093167 8:33854667-33854689 ATCCCAACTCTACTTGAACATGG - Intergenic
1040788996 8:51202598-51202620 CTAACAGCATTTATTGAACAGGG + Intergenic
1042344778 8:67716219-67716241 TACCCAGCACTTATTCAAGATGG - Intronic
1043817955 8:84826197-84826219 ATCCCATCACCTAGTGAGCATGG - Intronic
1046019237 8:108644260-108644282 CTAACAGCATTTATTGAACAGGG - Intronic
1047656361 8:126981734-126981756 TTCCCAGCATTTATTAAATAGGG + Intergenic
1048577067 8:135701259-135701281 ATCCCAGACCTTATGGAACCAGG + Intergenic
1050632049 9:7570195-7570217 ATCCCAGCACTTGATGACAATGG - Intergenic
1057080895 9:92173749-92173771 GTCTCAGCACTTATTTAAGAAGG - Intergenic
1058861453 9:109120907-109120929 ATCCCAGCACTTTTCCAATAGGG - Intergenic
1061710272 9:132482582-132482604 TTCCCATCACTCATTAAACAGGG - Intronic
1062702629 9:137915570-137915592 GTCCCAGCACTTTTAGAAAAAGG + Intronic
1185741837 X:2539816-2539838 ATTCCATGACTAATTGAACAAGG - Intergenic
1187058498 X:15763457-15763479 ATCACAGCACTGATTGCACTTGG + Intronic
1189026668 X:37402393-37402415 TTCCCAGCCCTTATTAAATAGGG - Intronic
1190052358 X:47159735-47159757 ATCCCAGCACTTATTGAACAGGG - Intronic
1190390483 X:49926448-49926470 ATTCTAACACTTATTCAACATGG - Intronic
1190878154 X:54474463-54474485 TTCCCAGCACTGAGGGAACAGGG + Intronic
1192962277 X:76143756-76143778 ATCCCAGGACCCATAGAACAAGG + Intergenic
1192963256 X:76151331-76151353 ATCCCAGGACCCATAGAACAAGG - Intergenic
1193162995 X:78249326-78249348 TTCCCAGCACCTATTGAAAAGGG + Intergenic
1194396817 X:93396029-93396051 ATCACAGCAATTATTAGACAAGG - Intergenic
1195744168 X:108097800-108097822 TTCCCAGCACTTACTAAATAAGG + Intronic
1195994940 X:110722247-110722269 ATCCCAGCACTTTGGGAAGATGG - Intronic
1196238527 X:113311544-113311566 ATCCCATCATTTATTGAATAAGG - Intergenic
1198396393 X:136223199-136223221 CTCCCAGCGCTTTTTGAAAATGG + Intronic
1198484228 X:137070456-137070478 ATCACAGCACCTACTGCACAGGG - Intergenic
1201387374 Y:13456377-13456399 ATCCCAGCACTCTGAGAACAAGG + Intronic
1201721605 Y:17104438-17104460 ATCCCAGCACTTTTTGAGGTTGG + Intergenic
1201958786 Y:19655334-19655356 ATCTCATCACTTATTGATGAGGG + Intergenic
1202017247 Y:20422982-20423004 GTCCCAGCACTAATTTAAAATGG + Intergenic