ID: 1190053432

View in Genome Browser
Species Human (GRCh38)
Location X:47168895-47168917
Sequence GGGGCACCTTGGTTGTGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190053432_1190053445 22 Left 1190053432 X:47168895-47168917 CCAGGCCACAACCAAGGTGCCCC No data
Right 1190053445 X:47168940-47168962 ACCAGAGAGTGACATAGGGATGG No data
1190053432_1190053437 -6 Left 1190053432 X:47168895-47168917 CCAGGCCACAACCAAGGTGCCCC No data
Right 1190053437 X:47168912-47168934 TGCCCCATGAGGGAAGCCAGTGG No data
1190053432_1190053441 -1 Left 1190053432 X:47168895-47168917 CCAGGCCACAACCAAGGTGCCCC No data
Right 1190053441 X:47168917-47168939 CATGAGGGAAGCCAGTGGCATGG No data
1190053432_1190053447 29 Left 1190053432 X:47168895-47168917 CCAGGCCACAACCAAGGTGCCCC No data
Right 1190053447 X:47168947-47168969 AGTGACATAGGGATGGAGAGAGG No data
1190053432_1190053444 18 Left 1190053432 X:47168895-47168917 CCAGGCCACAACCAAGGTGCCCC No data
Right 1190053444 X:47168936-47168958 ATGGACCAGAGAGTGACATAGGG No data
1190053432_1190053443 17 Left 1190053432 X:47168895-47168917 CCAGGCCACAACCAAGGTGCCCC No data
Right 1190053443 X:47168935-47168957 CATGGACCAGAGAGTGACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190053432 Original CRISPR GGGGCACCTTGGTTGTGGCC TGG (reversed) Intronic