ID: 1190054040

View in Genome Browser
Species Human (GRCh38)
Location X:47171554-47171576
Sequence CATGATGCACACATGCAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 199}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190054040_1190054046 5 Left 1190054040 X:47171554-47171576 CCATTTTGCATGTGTGCATCATG 0: 1
1: 0
2: 0
3: 16
4: 199
Right 1190054046 X:47171582-47171604 GACGCTCACCGGGCCAGTGCTGG 0: 1
1: 0
2: 1
3: 7
4: 117
1190054040_1190054043 -6 Left 1190054040 X:47171554-47171576 CCATTTTGCATGTGTGCATCATG 0: 1
1: 0
2: 0
3: 16
4: 199
Right 1190054043 X:47171571-47171593 ATCATGGGCCAGACGCTCACCGG 0: 1
1: 0
2: 0
3: 8
4: 61
1190054040_1190054044 -5 Left 1190054040 X:47171554-47171576 CCATTTTGCATGTGTGCATCATG 0: 1
1: 0
2: 0
3: 16
4: 199
Right 1190054044 X:47171572-47171594 TCATGGGCCAGACGCTCACCGGG 0: 1
1: 0
2: 0
3: 7
4: 93
1190054040_1190054048 15 Left 1190054040 X:47171554-47171576 CCATTTTGCATGTGTGCATCATG 0: 1
1: 0
2: 0
3: 16
4: 199
Right 1190054048 X:47171592-47171614 GGGCCAGTGCTGGCTATTGCTGG 0: 1
1: 0
2: 0
3: 11
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190054040 Original CRISPR CATGATGCACACATGCAAAA TGG (reversed) Intronic
902511891 1:16971183-16971205 CATCATACACACAGGCACAAAGG - Intronic
903399488 1:23030168-23030190 CATGATACACACAATTAAAAAGG + Intronic
903731545 1:25499975-25499997 GATGATTCAAAAATGCAAAATGG - Exonic
904867809 1:33595685-33595707 CATGATGGAGACATGTCAAAGGG - Intronic
907047350 1:51307338-51307360 CATGATGTCCACATGCTATATGG + Intronic
907264255 1:53246713-53246735 CATGATGCACATAACCAAATGGG - Exonic
912110642 1:106337693-106337715 AATGCAGCACATATGCAAAATGG - Intergenic
912896279 1:113593840-113593862 CATGATCCACACAGGAAAAAAGG - Intronic
917341341 1:173981375-173981397 CATGATGCTCACATGCTCATTGG - Intronic
920668583 1:207985271-207985293 CATGATTTACACATGGATAAAGG - Intergenic
921411012 1:214836357-214836379 CAGGATGCAGACATGCACAGAGG + Intergenic
921431801 1:215074289-215074311 CATGATGCAAAAAGGTAAAAGGG + Intronic
922499964 1:226089682-226089704 CAAAATGCAGTCATGCAAAAAGG - Intergenic
924721753 1:246629577-246629599 AATTTTGCACAAATGCAAAAAGG + Intronic
1063796001 10:9515140-9515162 CAGGATGCAGACCTCCAAAATGG + Intergenic
1065570011 10:27061206-27061228 CTTGATCCACTCATGCAAGAAGG + Exonic
1066077750 10:31897352-31897374 CATGACGCACACACACTAAAAGG + Intronic
1067230702 10:44406971-44406993 CCTGATGCACACAAGCAATGGGG - Intergenic
1068079226 10:52298922-52298944 AATGATGCACACATGAAAACTGG + Intergenic
1072808458 10:98441493-98441515 CATAATCCATAAATGCAAAATGG + Intronic
1073589200 10:104740083-104740105 CATGATTAAAACATGCAAAAAGG + Intronic
1074720327 10:116258616-116258638 CATGTTACATACATGCAAATGGG + Intronic
1075312527 10:121426649-121426671 TATGATCCACACCAGCAAAATGG - Intergenic
1077196772 11:1284955-1284977 CATCCTGCACAGATGCAGAAAGG - Intronic
1080919921 11:36698649-36698671 AATGTGGCACACATACAAAATGG + Intergenic
1082263979 11:50099826-50099848 CAGGTTGCACACCTGTAAAATGG - Intergenic
1086024116 11:82269364-82269386 CAAGATGCACAAATGAACAAAGG + Intergenic
1087516481 11:99168955-99168977 CATGATGCTCACCTGGAACATGG + Intronic
1089261426 11:117226443-117226465 CATGGTGTAAAAATGCAAAATGG - Intronic
1089604699 11:119635176-119635198 CATGATGCACACACACCCAAGGG - Intronic
1090601269 11:128374543-128374565 CATTATTCACACTAGCAAAAAGG - Intergenic
1092496326 12:8998767-8998789 CTTGTTGAACATATGCAAAATGG - Intronic
1093581770 12:20791512-20791534 CATGATGGACTCTTACAAAAAGG + Intergenic
1095869674 12:47012571-47012593 CATAAAGCCCACATGCATAATGG + Intergenic
1096235790 12:49925423-49925445 CAGGATGCATACACACAAAAGGG - Intergenic
1096973729 12:55686518-55686540 GATGATTCACACTTGCCAAAGGG + Intronic
1098251249 12:68571717-68571739 CCTGATCCACACCAGCAAAATGG - Intergenic
1099482519 12:83186729-83186751 CATGAAGCACTGAAGCAAAATGG + Intergenic
1100548499 12:95625154-95625176 TATGAAACACAGATGCAAAATGG + Intergenic
1101244256 12:102870507-102870529 CATGATGCATTTGTGCAAAATGG + Intronic
1102941532 12:116946778-116946800 TGTGATGCACACAGGCAGAAAGG + Intronic
1106205284 13:27587471-27587493 CATGATCCTGAAATGCAAAAAGG + Intronic
1106936197 13:34723483-34723505 CAGGCAGAACACATGCAAAAAGG - Intergenic
1107004279 13:35590054-35590076 GTTGATGTACACATGGAAAATGG + Intronic
1108621052 13:52184185-52184207 AATAATACACACATGCAATAAGG + Intergenic
1108680130 13:52772993-52773015 AATGATGTGCAGATGCAAAATGG - Intergenic
1109247956 13:59980394-59980416 CATCATCCACTCATTCAAAAAGG + Intronic
1111120241 13:83839121-83839143 CAACATGCAAACATGCAAAGAGG + Intergenic
1111886810 13:94031652-94031674 CATGCTGCCCAAATGCAAAATGG + Intronic
1112352277 13:98646180-98646202 GATGATGCATTCATGCAAAAGGG - Intergenic
1113242516 13:108354218-108354240 CATGACTCAGACATGCAAAGGGG + Intergenic
1116125734 14:40782293-40782315 CTTGAGGCAGACATGAAAAATGG - Intergenic
1118467579 14:66045021-66045043 CTTGATGCATTCATGCAAAGAGG - Intergenic
1119032009 14:71200142-71200164 CAAGATGCACAGATGCAGTAAGG + Intergenic
1119065657 14:71523680-71523702 TTTAATGGACACATGCAAAAAGG - Intronic
1120220885 14:81731469-81731491 AATTATGCACACATATAAAATGG + Intergenic
1121430559 14:93883989-93884011 CATATTGCACACAGGCAATATGG - Intergenic
1122039107 14:98969853-98969875 CATGATGGACACAAGCAGGAGGG + Intergenic
1123787101 15:23684984-23685006 CATGGGCCACACATACAAAAAGG - Intergenic
1126374886 15:47987649-47987671 CATGTTGCAGAAATGCCAAAGGG - Intergenic
1126568998 15:50129669-50129691 AATGCAGCACAAATGCAAAAGGG + Intronic
1129761885 15:78133750-78133772 CATTGTGGACACATGCAATAGGG + Intronic
1132398690 15:101491474-101491496 CATGAGGCCCTCATGCAAACTGG + Intronic
1135146047 16:19963629-19963651 CATGGAGCACACCTGCAAAGGGG + Intergenic
1136104520 16:28020206-28020228 AGTGAAGCAGACATGCAAAATGG + Intronic
1138436285 16:57002111-57002133 AATGTGGCACACATACAAAATGG - Intronic
1138550813 16:57747389-57747411 CATGAGCCACACATGCACAGTGG + Intronic
1141111690 16:81275639-81275661 AATGATGAATACATGAAAAATGG + Intronic
1144197384 17:12907651-12907673 CATTATGCAGCCATGAAAAAGGG - Intronic
1144261819 17:13528840-13528862 CGGGATGGACACATGCACAAAGG + Intronic
1145074426 17:19839929-19839951 CAAAATGCACACATACACAAAGG + Intronic
1146780257 17:35664400-35664422 CATGCTGCACACATGGCTAATGG + Intronic
1150016811 17:61565396-61565418 CATGCTGCACATATGCACCATGG - Intergenic
1153804063 18:8696753-8696775 CATGTAGCAAACATGCCAAAAGG + Intergenic
1159726753 18:71970353-71970375 CATGATGGAAAGATGCAAACAGG + Intergenic
1166438375 19:42788983-42789005 AATGATGCACGTAGGCAAAATGG - Intronic
1168456402 19:56513030-56513052 CATGAGGCACACAAACTAAAAGG - Intronic
1202642351 1_KI270706v1_random:106424-106446 CTTGATCCACTCATGCAAGATGG + Intergenic
926154079 2:10441443-10441465 CAAGAAGCACACATCCAAGAAGG + Intronic
929985095 2:46722273-46722295 ACTGATGCACACATGCTCAAAGG + Intronic
930889234 2:56363550-56363572 TATGAAGCTCCCATGCAAAATGG - Intronic
932975372 2:76593685-76593707 CAGGATTCACAAATGAAAAATGG - Intergenic
933478993 2:82830781-82830803 GATGAGACACACATGCAAATAGG + Intergenic
936724540 2:115297126-115297148 CATGCTGCTCACATAGAAAATGG - Intronic
939569935 2:143829223-143829245 CACTATGCACACATGCAGAAGGG + Intergenic
939862875 2:147440534-147440556 TATGCTGCATACATGTAAAATGG + Intergenic
940967297 2:159853476-159853498 CTTGATGCTAACATGCAAAAGGG + Intronic
941378176 2:164756761-164756783 AAAGATACACACTTGCAAAAAGG + Intronic
943137750 2:183937310-183937332 GATGGTGCACACAGGCACAATGG - Intergenic
944090569 2:195905357-195905379 CATGATTAACAAATGAAAAATGG - Intronic
948772928 2:240260915-240260937 CAGAATGCACACATGCTCAAAGG + Intergenic
1170204918 20:13787698-13787720 GATGATGAACACAGGCAATATGG - Intronic
1170298833 20:14859420-14859442 TATGAAGCACACATGCACACAGG - Intronic
1172598329 20:36165970-36165992 GAGGATGCACACGTGCAAAGAGG - Intronic
1174707190 20:52669076-52669098 CATGATGCTCAGAAGCACAAAGG - Intergenic
1176110847 20:63410082-63410104 CATGCTGGACTCATGCAATAGGG + Intronic
1178051692 21:28754501-28754523 CATTTTGCCCACATGCTAAAAGG - Intergenic
1178406630 21:32329486-32329508 CATAATTCACACATGCCACAAGG - Intronic
1180220226 21:46353925-46353947 AATGGCGCACACATGGAAAAGGG + Intronic
1180389707 22:12216602-12216624 CCAGATGTACACATGGAAAATGG + Intergenic
1184492123 22:44815798-44815820 CCTGATGCATACAGCCAAAACGG - Intronic
1184550297 22:45200849-45200871 CATGAAGCACAGAGGCAAAAGGG + Intronic
1184964259 22:47956601-47956623 CATGGTGCAGACATGCAAACAGG - Intergenic
949123117 3:411950-411972 CATGATGCACCCTTGCACTATGG + Intergenic
950411670 3:12842023-12842045 CATCTTCCACATATGCAAAATGG - Intronic
950619234 3:14190062-14190084 CCTGATGCACACAAGCAATGGGG - Intronic
951049919 3:18082791-18082813 CATAATGCATACAAGTAAAATGG + Intronic
953905287 3:46865512-46865534 CATGATGAACACAAGGAAATTGG - Intronic
957643481 3:82888120-82888142 CATCCTTCTCACATGCAAAATGG - Intergenic
957651387 3:83009790-83009812 CATAATGTATACATGCAAATTGG - Intergenic
957922683 3:86766576-86766598 AATTATGCACACATCCAAAATGG + Intergenic
958597519 3:96246916-96246938 CATGATGTAAACAAGCCAAATGG - Intergenic
960302079 3:116015311-116015333 CATGATGCACATTTGAGAAAGGG + Intronic
960452529 3:117827907-117827929 AATGATGCACAAATGAAAACAGG - Intergenic
960698965 3:120422338-120422360 CAACATGCACACACACAAAATGG + Intronic
961171517 3:124800990-124801012 CCTGATGCACCCTTTCAAAAGGG + Intronic
961531392 3:127542425-127542447 CATGAGGGACACATGCAACCTGG + Intergenic
962010676 3:131387518-131387540 CCTGATGCACAGATGCAGATTGG + Intronic
962692787 3:137917246-137917268 CCTGATGCACACAAGCAATGGGG - Intergenic
962879016 3:139558810-139558832 CATGATGCACACATGGATCAGGG + Intergenic
964382419 3:156110873-156110895 CATGAAGCAGAAATGTAAAATGG + Intronic
966006688 3:175022251-175022273 CATGATGGACTAATACAAAATGG + Intronic
967141292 3:186562983-186563005 AATGAAGCCCACATGTAAAATGG + Intronic
970970551 4:21978693-21978715 CATCATGCAGACAGGCAAATAGG - Intergenic
977151979 4:93523848-93523870 CATGTTGCACAAAGGAAAAAAGG + Intronic
977153232 4:93540711-93540733 CATGATTTACACCTGGAAAATGG + Intronic
977323151 4:95545494-95545516 CAATATGCAAACATGCATAAAGG + Intronic
978453056 4:108858031-108858053 TGGGATGAACACATGCAAAAAGG + Intronic
979133715 4:117082262-117082284 CATGCTTCACCCATGTAAAAAGG - Intergenic
982406688 4:155028431-155028453 CAAGATGCAAATAAGCAAAAGGG - Intergenic
983278892 4:165655223-165655245 CAAAATTCAGACATGCAAAAAGG + Intergenic
987241666 5:16006283-16006305 GATGCTGCTCACATGCAGAATGG - Intergenic
988391906 5:30644893-30644915 TAAAATGCACACATGTAAAATGG + Intergenic
989436604 5:41420737-41420759 CATGAAACACAGATACAAAATGG + Intronic
990899351 5:60733711-60733733 CCTGATACACACAAGCAATAGGG + Intergenic
991931406 5:71756437-71756459 CATGATGAGCAGATGGAAAAAGG - Intergenic
992413337 5:76529218-76529240 AATGATGTACATATGAAAAAGGG + Intronic
993388453 5:87288549-87288571 CATAATGGACTCATGTAAAATGG + Intronic
993567811 5:89496856-89496878 CATGATCCTCTCATGCACAAGGG + Intergenic
995199225 5:109409116-109409138 CATTTTGCGCACATTCAAAATGG - Intronic
995928881 5:117410954-117410976 CATGAAGCTCACATTCTAAATGG - Intergenic
996240157 5:121189033-121189055 CATGACGCACACACAAAAAAGGG - Intergenic
997785837 5:136712623-136712645 CATGATGGAGACATGTCAAAGGG + Intergenic
998771077 5:145546456-145546478 CAAGATGTACACTTGTAAAAAGG + Intronic
1000468008 5:161604119-161604141 CCTGATGTACTCAAGCAAAATGG + Intronic
1001387442 5:171351599-171351621 CATGATTCACACTATCAAAATGG + Intergenic
1001620252 5:173077991-173078013 CATTATGCACAAAAGCCAAAAGG - Intronic
1003073600 6:2963776-2963798 CCTGATGCCCACATGCATACAGG + Intronic
1003347470 6:5283902-5283924 CATTTTGCACACATACAAACAGG + Intronic
1003482786 6:6548342-6548364 AATATTGCACACATGAAAAAAGG + Intergenic
1003715520 6:8641921-8641943 CATATTCCATACATGCAAAATGG + Intergenic
1004064765 6:12233242-12233264 CCTGATGAAAACAAGCAAAATGG - Intergenic
1004160955 6:13212482-13212504 CCTGATGCAAGTATGCAAAAGGG - Intronic
1004259715 6:14097338-14097360 CATGAAACACACATGGGAAAAGG + Intergenic
1009725458 6:67531540-67531562 CAGGATGCACCCATGAAACAGGG + Intergenic
1013415832 6:109923849-109923871 CTTGAATCACACATGCAAATAGG + Intergenic
1014909415 6:127072366-127072388 CTTAATGCACACATGAAAGAAGG + Intergenic
1017255875 6:152332795-152332817 TATGAAGCACACATAAAAAATGG + Intronic
1017372424 6:153728141-153728163 CCTGAGGCACACATTCAACATGG + Intergenic
1018117432 6:160600978-160601000 CACGATGCTCAGATGCAGAATGG - Exonic
1018200816 6:161393569-161393591 CATAATGAACACATTCAAAAGGG + Intronic
1019039108 6:169088579-169088601 CAAGACACAAACATGCAAAACGG + Intergenic
1020139532 7:5605089-5605111 CATGATGGACACATGAACAAGGG - Intronic
1021465518 7:20938654-20938676 CTTGAGGCACAGAAGCAAAATGG + Intergenic
1022276815 7:28863289-28863311 CATGATGATCACATGCAATGTGG + Intergenic
1023347375 7:39285293-39285315 CATGATGCACAGATTGACAAAGG + Intronic
1023668740 7:42554195-42554217 CATGTGGCTCACATGCAAATGGG + Intergenic
1023731513 7:43196443-43196465 CATGGTTCACTTATGCAAAACGG - Intronic
1024091270 7:45942217-45942239 CATGATGGCCAAATGCAACAAGG - Intergenic
1024158671 7:46651874-46651896 CATTTTCCACATATGCAAAATGG + Intergenic
1026818455 7:73530359-73530381 CATGATGCAGAAATGTCAAAGGG + Intergenic
1027545500 7:79522780-79522802 CATTATACACACAAGGAAAATGG - Intergenic
1027846974 7:83392554-83392576 CAACAGGCACACATGCAAAAAGG - Exonic
1028952531 7:96653070-96653092 CATTTTGCACATATGTAAAATGG - Intronic
1031031053 7:116735721-116735743 AATGATGTACACACACAAAAAGG - Intronic
1031215096 7:118880531-118880553 CAACATGTTCACATGCAAAATGG + Intergenic
1031765467 7:125771720-125771742 TATGATGAACACCTACAAAAAGG + Intergenic
1032319229 7:130870060-130870082 CATGATACATACATACAACAGGG - Intergenic
1037714254 8:21383565-21383587 GAGGATGCTGACATGCAAAAGGG + Intergenic
1038562197 8:28590194-28590216 CACTATGCAGAAATGCAAAAAGG + Intergenic
1039210355 8:35206148-35206170 AATGATGCACATATGCAATGTGG - Intergenic
1039250180 8:35654956-35654978 AATGATGCACAGATGGAAAGTGG + Intronic
1039390483 8:37176561-37176583 TGTGATTCAGACATGCAAAAAGG - Intergenic
1040615021 8:49026841-49026863 AATGATGCACTCTTGCTAAAAGG + Intergenic
1042794277 8:72643464-72643486 CATGAGTCAGACATACAAAATGG - Intronic
1043185005 8:77137425-77137447 TATGCTGCAAACATGCAAAGAGG + Intergenic
1043467981 8:80532822-80532844 CATCAAGCACAAACGCAAAAAGG - Intergenic
1045717317 8:105063236-105063258 CATGAAGCACTTATGCAAAATGG - Intronic
1045771365 8:105744074-105744096 CATGTTGTAGACATGCAAATAGG + Intronic
1046441143 8:114255714-114255736 CCAGATGCACAGATACAAAAAGG + Intergenic
1048720715 8:137321160-137321182 CAGTATGCTCATATGCAAAAAGG + Intergenic
1049122561 8:140752337-140752359 AATCACACACACATGCAAAAAGG + Intronic
1051589100 9:18758026-18758048 CAGGTTCCTCACATGCAAAATGG - Intronic
1052228472 9:26118401-26118423 AATGATGCAAATAAGCAAAATGG + Intergenic
1052710223 9:32045743-32045765 CCTGATGCCGACATTCAAAATGG - Intergenic
1052732510 9:32306451-32306473 CATCATGCTCACATGCATATGGG - Intergenic
1053150233 9:35738574-35738596 CATGATGGACTCATTGAAAATGG - Exonic
1055024985 9:71710195-71710217 CATAATGTACAGCTGCAAAATGG + Intronic
1055884289 9:81041139-81041161 CATAATACAGATATGCAAAAGGG - Intergenic
1056000030 9:82205396-82205418 CTTGGTGCACACTTGCAAAAGGG - Intergenic
1057448157 9:95133580-95133602 CATGAGGGCCACAGGCAAAAAGG + Intronic
1058118785 9:101115660-101115682 CATAATACACACATGCCATATGG - Intronic
1058986725 9:110214733-110214755 CATGAACCACACCTACAAAATGG + Intergenic
1059057000 9:110993845-110993867 AATTATGCAGACATGTAAAAAGG + Intronic
1059064554 9:111069336-111069358 CACGCTGGACAGATGCAAAAGGG - Intergenic
1062071881 9:134560157-134560179 CATGAGGCACACACACAACACGG - Intergenic
1185788453 X:2910080-2910102 CCGGATGCACACATGCACACTGG + Intronic
1187379067 X:18783751-18783773 CATGATGAATACATGCTAATTGG + Intronic
1188896442 X:35674565-35674587 CATGATGCCCACTGGCAAACCGG - Intergenic
1190054040 X:47171554-47171576 CATGATGCACACATGCAAAATGG - Intronic
1190468957 X:50756417-50756439 CATGACTCACACAAGCCAAAAGG - Intronic
1194108880 X:89806056-89806078 GATGATGCCCACATGCAATGGGG + Intergenic
1196321504 X:114345912-114345934 AATAATGCAAATATGCAAAAAGG + Intergenic
1197625704 X:128800126-128800148 CAAAATGCTCATATGCAAAAGGG - Intergenic
1199461089 X:148085942-148085964 CAAAATGAACACAAGCAAAATGG - Intergenic
1200461538 Y:3460787-3460809 GATGATGCCCACATGCAATGGGG + Intergenic