ID: 1190054606

View in Genome Browser
Species Human (GRCh38)
Location X:47174408-47174430
Sequence TCTCAGCCTCACCGCAGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 181}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190054606_1190054608 4 Left 1190054606 X:47174408-47174430 CCTGCGCTGCGGTGAGGCTGAGA 0: 1
1: 0
2: 2
3: 18
4: 181
Right 1190054608 X:47174435-47174457 GTCGTGTCTTTAACCGCCCCTGG 0: 1
1: 0
2: 0
3: 0
4: 16
1190054606_1190054609 14 Left 1190054606 X:47174408-47174430 CCTGCGCTGCGGTGAGGCTGAGA 0: 1
1: 0
2: 2
3: 18
4: 181
Right 1190054609 X:47174445-47174467 TAACCGCCCCTGGTTTCCAATGG 0: 1
1: 0
2: 1
3: 5
4: 46
1190054606_1190054610 15 Left 1190054606 X:47174408-47174430 CCTGCGCTGCGGTGAGGCTGAGA 0: 1
1: 0
2: 2
3: 18
4: 181
Right 1190054610 X:47174446-47174468 AACCGCCCCTGGTTTCCAATGGG 0: 1
1: 0
2: 0
3: 7
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190054606 Original CRISPR TCTCAGCCTCACCGCAGCGC AGG (reversed) Intronic
900792782 1:4690945-4690967 ACTCAGCCTCACAGAAGGGCAGG + Intronic
901526728 1:9827757-9827779 TTTCATCCTCACCGCAACTCCGG - Intergenic
901799857 1:11701727-11701749 CCTCCGCCTCCCCGCAGCCCGGG - Intronic
904302123 1:29561234-29561256 GCTCAGCTTCACCCCAGGGCTGG + Intergenic
904455166 1:30643057-30643079 GCTCAGCTTCACCCCAGGGCTGG - Intergenic
905123661 1:35702271-35702293 ATTCAGCCTCACAGCAGCCCCGG + Intergenic
909443713 1:75724830-75724852 TTCCAGCCCCACCGCACCGCTGG - Intronic
912532379 1:110335539-110335561 TCTCAGCCTCCCCAAAGCACTGG - Intergenic
914915952 1:151819381-151819403 TCTCAGCCTGACCTCTGCTCAGG - Intronic
918487524 1:185045448-185045470 TCCCGCCCTCCCCGCAGCGCCGG + Exonic
920535167 1:206732388-206732410 CGGCAGCCTCACCCCAGCGCTGG - Intronic
920645924 1:207804359-207804381 TGTCATCCTCCCCGCAGCTCAGG + Intergenic
921283111 1:213586322-213586344 GCTCGGCCACACCGCAACGCTGG + Intergenic
922169586 1:223143334-223143356 TCTCGGCCACGCCGCAGCTCAGG + Intergenic
1064035920 10:11913275-11913297 TCTCTGCCTGCCCGCAGCCCTGG - Intergenic
1067063501 10:43090184-43090206 TCTCAGCCTCACCCCTGCCCAGG - Intronic
1068894048 10:62179984-62180006 TCTCAGCCTCCCCAAAGTGCTGG + Intergenic
1069684982 10:70312197-70312219 TCTCAGCCTCAAGGCAGCTCTGG + Intronic
1070215912 10:74380506-74380528 TCTCAGCCTCCCCAAAGTGCTGG - Intronic
1071604587 10:86976339-86976361 CCTCAGCCTCCCCACAGCACTGG + Intronic
1072686737 10:97542143-97542165 TCTCAGCCTGACCCCCGCCCTGG - Intronic
1074053066 10:109897519-109897541 TCTAATCCTCACAGCAGCCCTGG + Intronic
1075697522 10:124447743-124447765 TCTCAGCCTCACCGAGACGCAGG - Exonic
1076415052 10:130280071-130280093 TGTCAGACTAGCCGCAGCGCTGG + Intergenic
1076722965 10:132400755-132400777 AGGCAGCCTCAGCGCAGCGCAGG - Intronic
1078549623 11:12271141-12271163 CCTCAGCCTCATCTCAGCTCTGG - Intergenic
1080151783 11:29059549-29059571 GCTCAGCCTCCCAGAAGCGCTGG - Intergenic
1080170792 11:29299985-29300007 TCTCAGCCTCCCCAAAGTGCTGG + Intergenic
1081678919 11:44988293-44988315 TCCCAGCCTGACCCCAGAGCTGG + Intergenic
1083239762 11:61379090-61379112 CCTCAGCCTCACCAAAGTGCTGG - Intergenic
1083740954 11:64711575-64711597 TCTCGGCCTCCGGGCAGCGCGGG + Intronic
1084207835 11:67606343-67606365 TCTCTGCCTCACCCCAGCCTAGG + Intronic
1084975815 11:72797418-72797440 TCTCAGCCTCCCCAAAGTGCTGG - Intergenic
1090363092 11:126186761-126186783 TCTTGGACTCAGCGCAGCGCTGG + Intergenic
1091346823 11:134859770-134859792 TCTCAGCCTTACCCCAGGGCAGG - Intergenic
1091831643 12:3554472-3554494 TCTCGGCCTCACTGCAGCCCCGG - Intronic
1091865572 12:3833348-3833370 TCTCAGCCTCACCAAAGCCCTGG - Intronic
1091998326 12:5013156-5013178 TCTCTGCCTCACCGTAGATCTGG - Intergenic
1092147394 12:6224042-6224064 TCTCAGCCGCACCTTAGGGCAGG - Intronic
1092219141 12:6700856-6700878 TCTCCGCCTCCCCCCCGCGCCGG + Intergenic
1092528538 12:9325796-9325818 CCTCACCCTCCCCGCAGCGGAGG - Intergenic
1096647668 12:53047407-53047429 TCTCTGCGTCACGGCCGCGCGGG + Intronic
1104592896 12:130098839-130098861 ACTCAGCCTCACAGCATCCCAGG - Intergenic
1113508515 13:110832854-110832876 CCTGAGCCTCACGGCAGCCCCGG + Intergenic
1115744106 14:36418407-36418429 TCTCTGCCTCACCTCAGAGCAGG + Intergenic
1118319242 14:64743499-64743521 TCCCAGCCCCACTGCAGGGCTGG + Exonic
1118749267 14:68794610-68794632 TCTTAGCCACTCCGCAGCACCGG - Intronic
1119263890 14:73253239-73253261 TCACAGGCTCCCCGCAGGGCTGG + Intronic
1119380637 14:74226010-74226032 TCTCAGTCTCACTGCAGAGCAGG + Intergenic
1120761616 14:88290545-88290567 ACTAAGCCTCACCGCAGACCAGG + Intronic
1121489332 14:94346579-94346601 TCTCAGCCTCATCACATCACGGG - Intergenic
1202929123 14_KI270725v1_random:23282-23304 TGTCCGCCTCTCCGCCGCGCCGG + Intergenic
1124024993 15:25957767-25957789 CCTCAGCCTCAGTGCTGCGCAGG - Intergenic
1124378303 15:29142510-29142532 TCTCCGCCTCACCCCAGCACTGG - Intronic
1124439440 15:29675610-29675632 CCTCAGCCTCCCCGAAGTGCTGG - Intergenic
1125937326 15:43648617-43648639 TCTGGGCCTCACCTCAGCCCAGG + Exonic
1125950229 15:43746036-43746058 TCTGGGCCTCACCTCAGCCCAGG + Intergenic
1127078555 15:55352196-55352218 CCTCAGCCTCCCCAAAGCGCTGG + Intronic
1128482965 15:68055002-68055024 TCTCAGCCGAACCCCAACGCCGG - Intronic
1128507520 15:68285780-68285802 TCTTAGCCCCCCCGCAGTGCTGG + Intronic
1128894140 15:71357325-71357347 TCTCAGCAACACCTCAGCGATGG - Intronic
1129284351 15:74512276-74512298 TCTCAGCCTCACCGCAAAGCAGG - Intergenic
1132723808 16:1330212-1330234 TCCAAGCCTCACCGCAGCAGGGG + Intergenic
1134483022 16:14634530-14634552 TCTAAACCTCACAGCAGGGCGGG + Intronic
1135532432 16:23266035-23266057 TCTCAGCCTCACACCACCCCTGG + Intergenic
1137570204 16:49560426-49560448 TCCCAGCCCAACCGCAGAGCTGG - Intronic
1138111421 16:54327251-54327273 CCTCAGCCTCACCAAAGTGCTGG - Intergenic
1139878085 16:70162691-70162713 TCTTACCCTCCCTGCAGCGCTGG + Intergenic
1142614456 17:1126432-1126454 TCTCACACTCATCGCAGAGCAGG + Intronic
1143223553 17:5282037-5282059 ACTCAGCCTCCCCGCGCCGCTGG + Intergenic
1143236922 17:5410478-5410500 TCTCAGCCTCCCCAAAGTGCTGG - Intronic
1145060117 17:19727916-19727938 TCTCAGCCTCTTAGCAGAGCAGG - Intergenic
1145197620 17:20908591-20908613 CCTGAGCCCCAGCGCAGCGCAGG + Intergenic
1148242727 17:46011055-46011077 TCTCTGCCACACCTCAACGCTGG - Intronic
1148430495 17:47639292-47639314 TCTCAGCCTCCCCAAAGTGCCGG - Intergenic
1148552852 17:48560824-48560846 TCTCAGCCTCACCCCAACCCTGG - Intronic
1148902022 17:50885387-50885409 CCTCAGCCTCACCTCAGGCCAGG - Intergenic
1150227114 17:63530242-63530264 ACTCTGCCTCACCGGAGCCCAGG - Exonic
1151340603 17:73468400-73468422 TCTGAGCCTCACCCCAGCTCAGG - Intronic
1152403985 17:80086233-80086255 TCTCAGCATCACTGCAGGGCCGG - Intronic
1152563647 17:81090736-81090758 CCGCAGCCTCCCCGCAGCTCGGG - Intronic
1152756945 17:82090980-82091002 TCACAGCCTCATCGGAGCGTAGG + Exonic
1152825480 17:82462112-82462134 TCTCATCCTCACCACAGTCCTGG - Intronic
1154492776 18:14934106-14934128 CCACAGCCTCACTGCAGGGCAGG + Intergenic
1155204413 18:23545491-23545513 CCTCAGCCTCCCCAAAGCGCTGG + Intronic
1155324754 18:24654532-24654554 CCTCAGCCTCACAGAAGAGCTGG + Intergenic
1157529674 18:48409973-48409995 TCTCTGCCGCACCGCTGCCCCGG - Intronic
1157529684 18:48410010-48410032 TCTCTGCCGCACCGCTGCCCCGG - Intronic
1160024097 18:75204702-75204724 TCTCAACTCCACCGCGGCGCCGG - Intronic
1160418070 18:78725674-78725696 TTTCAGCCACACAGCAGCGGTGG - Intergenic
1161495644 19:4584436-4584458 GCTCAGCCTCACCCCATCCCGGG - Intergenic
1161571158 19:5031556-5031578 TCTCAGCAGCAGCCCAGCGCGGG + Intronic
1161601442 19:5186170-5186192 CCTCAGCCTCCCCACAGGGCTGG + Intronic
1161989181 19:7674459-7674481 TCTCAGCCCCACCCAAGCCCGGG + Intergenic
1162364232 19:10238218-10238240 TCTCATCATCGCCCCAGCGCTGG + Intergenic
1162397472 19:10425399-10425421 TATCAGCCTCACCACAGCCCTGG - Intronic
1165843643 19:38804238-38804260 TCTTGGCCACACCTCAGCGCAGG + Intronic
1165864245 19:38926380-38926402 TCTCTGCCTCACTGCGCCGCAGG - Intronic
1166144550 19:40825057-40825079 TTCCAGCCTCACCCCAGAGCAGG - Intronic
1166183192 19:41123004-41123026 TTCCAGCCTCACCCCAGAGCAGG + Intronic
1167328309 19:48838053-48838075 TCTCAGCCTCTCCCAAGCCCTGG - Exonic
1167574611 19:50312117-50312139 TCTCAGCCCACCCGCAGGGCAGG - Intronic
927904688 2:26848189-26848211 TCTCCGTCTCGCCGCGGCGCCGG - Exonic
928518343 2:32064221-32064243 TCTCATCCTCATCGATGCGCAGG - Exonic
932568516 2:72924472-72924494 TCTCAGCCTCTCCGAGACGCAGG + Exonic
938300337 2:130206578-130206600 CCTCAGCCTCACCAAAGTGCTGG - Intergenic
940654029 2:156466916-156466938 TCTCAGCCTCAAAGGAGGGCAGG - Intronic
946133885 2:217629505-217629527 TCTCAGCCACCCCACAGAGCAGG + Intronic
947810885 2:233003300-233003322 TCCCAGACCCACAGCAGCGCGGG + Intronic
1169262526 20:4149014-4149036 TCTCAGCCTCCCCCGGGCGCAGG + Intronic
1169444439 20:5659650-5659672 TCTGGGCCCCACCCCAGCGCAGG - Intergenic
1174017659 20:47501898-47501920 TCTCAGCCGCTCCACAGCGACGG + Intronic
1176015906 20:62932122-62932144 TCTCAGCCTCCCCAAAGTGCTGG + Intronic
1176216215 20:63949181-63949203 ACTCAGCCTCACCTCGGCTCCGG + Intronic
1178793383 21:35721279-35721301 CCTGAGCCTAACCTCAGCGCTGG - Intronic
1180978248 22:19863246-19863268 TCTCAGCCTCCCCAAAGTGCTGG + Intergenic
1181732851 22:24859980-24860002 GCTCAGCCTCCCCGCAGCTGTGG + Intronic
1182558297 22:31140781-31140803 TCTCACCCTTACCACAGCGGTGG + Intergenic
1182709573 22:32312086-32312108 TCTCAGGCTGACCACAGGGCAGG - Intergenic
1182895649 22:33857165-33857187 TCTCAGCCTCCCAGAAGTGCTGG + Intronic
1184069273 22:42138100-42138122 TCTCAACCTCACCACAGGACTGG - Intergenic
1184397129 22:44248946-44248968 TCTCAGGCTGACCACAGGGCAGG - Exonic
1185289078 22:50015041-50015063 TCTCGGCCTCAGCTCCGCGCAGG + Intergenic
949573103 3:5312218-5312240 TCTCAGCTTCACCACTGCTCAGG + Intergenic
950065077 3:10105633-10105655 CCTCAGCCTCCCCACAGAGCTGG - Intronic
953687448 3:45089112-45089134 TGTCATCCTCATCGCAGCGGTGG - Exonic
955368662 3:58332693-58332715 TCGCAGCCGCACCGCAGACCCGG - Intergenic
959063506 3:101636013-101636035 CCTCACCCTCCCCGCAGCGGAGG + Intergenic
961559721 3:127720259-127720281 CCTCAGTCTCACCCCAGTGCTGG - Intronic
962101119 3:132343881-132343903 TCTCAGCCTCCCAGAAGTGCTGG - Intronic
962263289 3:133928319-133928341 TCTCAGTCTCAAGGCAGAGCGGG - Exonic
965605739 3:170496247-170496269 TCTCAGCCTCAGCCCAGCTGCGG - Intronic
966612342 3:181880247-181880269 TCTCAGCCTCACCAGAGGTCAGG - Intergenic
967878082 3:194280300-194280322 GCTCAGCCACACTGCAGCCCTGG + Intergenic
968582928 4:1403261-1403283 GCTCAGCCTCACCGAGACGCAGG - Exonic
968701400 4:2059692-2059714 GCTCAGCCTCACGGCGGGGCGGG + Exonic
968956994 4:3724542-3724564 TCCCAGCCTCATCCCAGAGCCGG - Intergenic
970884627 4:20973773-20973795 TCTCACCCTCTCCACAGGGCCGG - Intronic
971027928 4:22606879-22606901 TCTAACCCTCACCGGAGAGCAGG + Intergenic
971109481 4:23567712-23567734 CCTCAGCCTCTCCACAGTGCTGG + Intergenic
976755676 4:88495296-88495318 CCTCAGCCTCCCCGCAGTGCTGG - Intronic
982136662 4:152279352-152279374 TCTCAGGCTCACCCCCACGCTGG - Intergenic
984754810 4:183315132-183315154 TCTCAGCCTCTCCGCTGCTTCGG + Intronic
985575955 5:673606-673628 TCTCAGCCTCAACCCCTCGCTGG + Intronic
985576345 5:675147-675169 TCTCAGCCACACTGCACCCCTGG - Intronic
987054925 5:14182227-14182249 CCTGAGCCTCACAGCAGAGCCGG - Intronic
987078941 5:14409147-14409169 TCTCAGCCCCAGCACAGCCCTGG + Intronic
991056091 5:62322178-62322200 TCTCAGCCTCTCAGAAGTGCTGG + Intronic
991413356 5:66366946-66366968 CCTCAGCCTTAGCGCAGAGCAGG + Intergenic
991492369 5:67195659-67195681 TCTGAGCCTTACCCCAGTGCTGG + Intronic
994176166 5:96713722-96713744 CCTCAGCCTCCCCGAAGTGCTGG - Intronic
1000092923 5:157945936-157945958 TCTCAGCTTCCCCGCATAGCTGG + Intergenic
1001452336 5:171836378-171836400 TCTGACCCTCACCGCTGTGCTGG - Intergenic
1001514782 5:172347752-172347774 TTTCATCCTCACCGCTGCCCTGG - Intronic
1002201972 5:177534057-177534079 CCTCAGCCTCAGCCCAGCGTTGG - Intronic
1002366426 5:178716143-178716165 CCTCAGCCTCCCCAAAGCGCTGG + Intronic
1002577015 5:180179613-180179635 TCCCAGCCTCTCGGCAGCGTGGG - Intronic
1003208337 6:4035715-4035737 TCTCAGCCTCCCCAAAGTGCTGG - Intronic
1005752151 6:28893604-28893626 CCTCAGCCTCACCCAAGTGCTGG + Intergenic
1006451986 6:34110695-34110717 CCTCAGCCTCCCCGCTGTGCCGG + Intronic
1006578891 6:35065221-35065243 TCACTGCCTGACTGCAGCGCAGG + Intronic
1014137646 6:117907583-117907605 TCCCCGCCTCACCGCTTCGCAGG + Exonic
1018862646 6:167722284-167722306 GCTCAGCCTCACAGCAGCGCAGG + Intergenic
1019283059 7:210215-210237 TCTCAGGCCCCCCGCAGGGCTGG - Intronic
1019302858 7:317461-317483 TCTCAGCCTGACCACACTGCGGG + Intergenic
1019449302 7:1088509-1088531 TCTCAGCGTGACCGCAGCAGGGG + Intronic
1019542820 7:1559236-1559258 TCTCAGCCTCCCCACAGCTCTGG - Intronic
1022501958 7:30887408-30887430 TCTCAACCTCACAGCAGCTCAGG - Intronic
1025004363 7:55343237-55343259 TCTGAGCCTCCCCGAAGCCCAGG - Intergenic
1026665289 7:72336269-72336291 TCGGAGCCGCACCGCAGCCCAGG - Intronic
1029416127 7:100444376-100444398 TCTCTGCCTCCTCGCAGCCCTGG + Intergenic
1031064934 7:117094631-117094653 TCTCAGCCTCAGAGCAGTTCTGG + Intronic
1031080774 7:117255101-117255123 CCTCAGACTCACCACAGAGCTGG - Intergenic
1031614722 7:123867032-123867054 TCTCGGCCTCACCAAAGTGCTGG + Intronic
1033248911 7:139741917-139741939 TCTAAGCCTCACGGCAACCCTGG + Intronic
1033324878 7:140369078-140369100 TCTGAGCCCCACCGCATCTCTGG + Intronic
1035889957 8:3332446-3332468 CATCAGCCTCACTGCAGCTCCGG - Intronic
1038917106 8:32036945-32036967 TCTCAGCCTCAGCTCAGTTCAGG + Intronic
1041713977 8:60916928-60916950 TCTCTGCCCCACCCCAGTGCAGG - Intergenic
1044656190 8:94550967-94550989 CCTCAGCCTCACCAAAGTGCCGG + Intronic
1045271366 8:100664608-100664630 CTTCAGCCTCACCGAAGTGCTGG + Intergenic
1045359057 8:101415163-101415185 TCTCAGCCTCTCCCCAGGGAAGG + Intergenic
1047404018 8:124569907-124569929 TCTCTGCCCCACCGCCTCGCAGG + Intronic
1049535902 8:143181629-143181651 TCACAGCCTCACCCCAGGGCAGG + Intergenic
1049835983 8:144735844-144735866 TCTCAGTCACACGGCAGCTCTGG + Intronic
1055153082 9:73026593-73026615 CCTCAGCCTCCCCGAAGTGCTGG - Intronic
1055454403 9:76459343-76459365 TCTCAGCCTTCCCCCACCGCCGG - Intronic
1056991880 9:91421114-91421136 TCTGAACCTCACCGCAGAACAGG + Intronic
1059231873 9:112728123-112728145 CCTCAGCCTCACCAAAGTGCTGG - Intergenic
1060517267 9:124273749-124273771 TCGCAGCCTCACTGCAGCAGGGG + Intronic
1062260986 9:135663348-135663370 GCTGAGCCTCATCGCAGCCCAGG + Exonic
1062534755 9:137016562-137016584 TGCCAGCCTCACCAAAGCGCCGG + Exonic
1187282438 X:17868023-17868045 TCTCGGCCTCACCACAGAGACGG - Intergenic
1189893820 X:45632894-45632916 TCTCAGCCTCAGCCCAGCTGCGG + Intergenic
1190054606 X:47174408-47174430 TCTCAGCCTCACCGCAGCGCAGG - Intronic
1190870804 X:54423259-54423281 TCTAAGCCTCAGCGCTGCGCGGG + Intergenic
1191220732 X:57985498-57985520 TCTCAGCCTCAGCCCAGCTGCGG - Intergenic
1196782957 X:119399481-119399503 CCTCAGCCTCACCGCGCCCCTGG + Exonic
1199944192 X:152652576-152652598 TCTCCCCATCACCCCAGCGCAGG + Exonic
1200049235 X:153419956-153419978 TCTCAGCCTCCCTGCAGGCCAGG + Intronic
1200123220 X:153800948-153800970 TCTCTGCCGCACAGCAGCTCTGG - Intergenic
1201254081 Y:12089831-12089853 TCTTAGCCTCACTGCAATGCAGG - Intergenic