ID: 1190054965

View in Genome Browser
Species Human (GRCh38)
Location X:47175988-47176010
Sequence CCCATGGATGGCTGGGTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 245}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190054965_1190054972 -8 Left 1190054965 X:47175988-47176010 CCCAGGACCCAGCCATCCATGGG 0: 1
1: 0
2: 2
3: 29
4: 245
Right 1190054972 X:47176003-47176025 TCCATGGGAAGACGGCCTCATGG 0: 1
1: 0
2: 0
3: 10
4: 95
1190054965_1190054975 18 Left 1190054965 X:47175988-47176010 CCCAGGACCCAGCCATCCATGGG 0: 1
1: 0
2: 2
3: 29
4: 245
Right 1190054975 X:47176029-47176051 AAACTTCCATCTGTTCGAAATGG 0: 1
1: 0
2: 1
3: 8
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190054965 Original CRISPR CCCATGGATGGCTGGGTCCT GGG (reversed) Intronic
900314424 1:2050027-2050049 CCCCTGGACGGCGGGGCCCTCGG + Intergenic
900616211 1:3566783-3566805 ACCTGGGCTGGCTGGGTCCTCGG + Intronic
900713700 1:4130638-4130660 ACCTTGAATGGCAGGGTCCTAGG + Intergenic
902908581 1:19578204-19578226 TCCATGGATGCCTGGGTCTCTGG - Intergenic
903045868 1:20563764-20563786 CAGATGGCTGGCTGGGCCCTGGG + Intergenic
903269363 1:22178036-22178058 CCCAAGGAAAGCAGGGTCCTGGG - Intergenic
903277904 1:22233288-22233310 CCAATGGAGGCCTGGATCCTGGG + Intergenic
903944343 1:26952219-26952241 CCCATGGTGGCCAGGGTCCTTGG + Exonic
904117802 1:28175331-28175353 CCCTTAGATGACTGGGTCCTGGG - Intronic
905272377 1:36795425-36795447 CCCAGGGATGACTGTGTCCCAGG - Intergenic
906344218 1:45005205-45005227 CTCATTGATGGCTCGGCCCTGGG - Intronic
906746559 1:48226090-48226112 CCCAGGGATGGCGGGGAGCTGGG + Intronic
906782964 1:48589024-48589046 TCCCTGGAAGGCTGGGTCATAGG - Intronic
909167402 1:72246789-72246811 CTCATAGATGGCTGCGTACTAGG - Intronic
910028713 1:82689514-82689536 CCCATGTGTGGCTGAGTCCTGGG + Intergenic
910065336 1:83144210-83144232 CCCATGGGTGGAGGGGTCCTAGG + Intergenic
910786641 1:91006248-91006270 GCCGTGGTTGGCTAGGTCCTGGG - Intronic
911232341 1:95374369-95374391 CCAATAGATGGCTGGGGCCCGGG + Intergenic
912734258 1:112136009-112136031 CCCATACAAGGCTGGGCCCTAGG + Intergenic
913318559 1:117573460-117573482 CCCACAGCTGGCTGGGGCCTGGG - Intergenic
913532337 1:119741987-119742009 CCGATGCAAGGCTGGGACCTAGG - Intronic
916163420 1:161942340-161942362 CCCCAGGATGGCTGATTCCTAGG + Intronic
916389196 1:164312019-164312041 CCTATGGATGCATGGCTCCTTGG - Intergenic
916514003 1:165498301-165498323 TCCCTGGATGGCTGGGTCTTTGG - Intergenic
916583127 1:166126172-166126194 TCCATGGTTGGCTGACTCCTTGG + Intronic
916746781 1:167690918-167690940 CCCAGGGCTGGCTGGCTCCCTGG + Intronic
917521274 1:175750175-175750197 CCAATAGTTGCCTGGGTCCTGGG + Intergenic
920294347 1:204946773-204946795 CCCAGGGATGGTGGGGGCCTCGG - Intronic
922215515 1:223516530-223516552 CCCATTGTTGTCTGGGTTCTGGG + Intergenic
923617270 1:235548380-235548402 TCCAGGGATGGCAGCGTCCTGGG - Exonic
1062824288 10:557004-557026 ACCATCGAGGGCTGGCTCCTGGG - Intronic
1063473324 10:6306708-6306730 CCCATGGAAGGCCGTGTCCTGGG + Intergenic
1063621257 10:7651180-7651202 CCCAGGGCTGGCTTGTTCCTAGG + Intronic
1064009118 10:11721265-11721287 GCCAAGGATGGCAGGGTCATTGG + Intergenic
1064643064 10:17433888-17433910 CCTCGGGATGGCTGGGTCCCAGG - Intronic
1066099652 10:32106445-32106467 CCCAAGGATTGCTGGAGCCTGGG + Intergenic
1067083507 10:43226502-43226524 CCCATGGATGGCGTGGATCTCGG - Intronic
1067218956 10:44327795-44327817 CCCAAAGAAGCCTGGGTCCTGGG + Intergenic
1068651522 10:59527999-59528021 CCCAAGGATGGAAGGGGCCTGGG + Intergenic
1068714871 10:60177054-60177076 GCCATGCATGGCTGGGCACTTGG - Intronic
1068788500 10:61001855-61001877 CCCAGAGGTGGGTGGGTCCTGGG - Intergenic
1073467851 10:103704697-103704719 CCCAGGGATGGGTGGCTCCTGGG + Intronic
1074147999 10:110733537-110733559 CCCATGCAGGGCTAGCTCCTTGG + Intronic
1074766471 10:116703751-116703773 CCCATGGATGGGTGGCACCCGGG + Intronic
1075579255 10:123604437-123604459 CCCATGTATCCATGGGTCCTGGG + Intergenic
1075786489 10:125053505-125053527 CCCAGGGATGAGTGGCTCCTGGG + Intronic
1076499417 10:130924550-130924572 CCCACGGAGGGCTGGGTGCTGGG - Intergenic
1076569257 10:131421547-131421569 CCCGTGGGTGCCTGGGTCATGGG + Intergenic
1077326323 11:1965577-1965599 CCCATTGATTGGTGGCTCCTCGG + Intronic
1077373353 11:2193868-2193890 CCCATGGAGGGCAGGCCCCTGGG + Intergenic
1077602310 11:3582077-3582099 CCCCTGCACGGCTGGGTCCCAGG - Intergenic
1081463047 11:43289344-43289366 CCCCAGTGTGGCTGGGTCCTGGG - Intergenic
1081665354 11:44913865-44913887 CCCAGGAATGGCTGGGTCCAGGG + Intronic
1082255621 11:50029380-50029402 ACGATGGATGGATGGGTCCTGGG - Intergenic
1082767344 11:57180255-57180277 CAGATTGATGGCTGTGTCCTTGG + Intergenic
1083799142 11:65036163-65036185 CCAATGGAGGTCAGGGTCCTGGG + Intronic
1084258203 11:67956628-67956650 CCCCTGCACGGCTGGGTCCCAGG - Intergenic
1085448244 11:76615435-76615457 CTCATGGAGGGCTGGGCCCCGGG - Intergenic
1085802229 11:79601216-79601238 CCCATGGCTGGCTGGCATCTGGG + Intergenic
1087277411 11:96174308-96174330 ACCATAGATGGCAGTGTCCTGGG - Intronic
1087601221 11:100318334-100318356 CTCATGGATGGCTGGGTTTAGGG - Intronic
1088418124 11:109612305-109612327 TTCATGGATGGCTGGATCATAGG + Intergenic
1089148801 11:116349014-116349036 ACCAGGGAAGGCTGGGTCCAAGG + Intergenic
1089334661 11:117714904-117714926 CACTTGGACGGCTGGGGCCTGGG - Intronic
1089391758 11:118107005-118107027 TCCATGGAGGGCTGAGTCATTGG - Intronic
1090780316 11:130001999-130002021 GCCATCGATGGCTGGGCCCCCGG - Intronic
1202809304 11_KI270721v1_random:20756-20778 CCCATTGATTGGTGGCTCCTCGG + Intergenic
1091798161 12:3308999-3309021 CACTGGGATGGCTGGGTTCTAGG + Intergenic
1092428451 12:8391429-8391451 CCCCTGCACGGCTGGGTCCAAGG - Intergenic
1092429534 12:8397581-8397603 CCCCTGCACGGCTGGGTCCAAGG - Intergenic
1092529641 12:9333886-9333908 CCCAGGGGTGGCTGGATGCTGGG - Intergenic
1096455158 12:51778924-51778946 ACCATGCCTGGCTGGGTTCTGGG - Intronic
1098226422 12:68329822-68329844 CCCAGGGAAGGCAGAGTCCTGGG - Intronic
1100455883 12:94751307-94751329 GCCATGGAGGGATGGGTCTTGGG + Intergenic
1103323027 12:120102652-120102674 CCCATGGATGGCTGGGAGTATGG - Intronic
1104965682 12:132507919-132507941 CCCTTCGATGGCTGAGCCCTGGG + Intronic
1108112607 13:47092227-47092249 CCCATGGAGGATTGGGGCCTGGG - Intergenic
1111187581 13:84759627-84759649 CCCATGGATGGCTGAAACCCTGG - Intergenic
1112459070 13:99587145-99587167 CCCCGGGACGGCTGGGTCATGGG + Intergenic
1113575688 13:111393831-111393853 CCAATGGATGGCAGAGACCTTGG - Intergenic
1115310681 14:31975081-31975103 CTCATGGATGCCTGGGTCATGGG + Intergenic
1117684336 14:58238044-58238066 TCCATCGATGGGTGAGTCCTTGG - Intronic
1118787239 14:69056075-69056097 ACCATGGAGGGCTGAGTGCTGGG - Intronic
1119134275 14:72202719-72202741 CCCTTGGAGGGGAGGGTCCTGGG + Intronic
1119387401 14:74266202-74266224 CTCAGGGATCGCTGGGACCTTGG + Intergenic
1121594095 14:95146444-95146466 CCCCAGTGTGGCTGGGTCCTGGG - Intronic
1121616923 14:95319669-95319691 CCCCGGGATGGCTGGGCGCTCGG - Intronic
1122080251 14:99262209-99262231 GCCAGGGAGGGCGGGGTCCTTGG - Intronic
1122520434 14:102339827-102339849 GCCATAGATGGATGTGTCCTGGG - Intronic
1125006777 15:34825403-34825425 CCCAGGGATGGCTGGGAACTGGG - Intergenic
1128242281 15:66109170-66109192 GCCATGGATGGCTGTGTTCAAGG - Intronic
1128643469 15:69357901-69357923 CCCATGGCTGGCTGGAAACTCGG - Intronic
1128682874 15:69664344-69664366 CCCATTCCTGGCTGGGCCCTAGG + Intergenic
1129045291 15:72728781-72728803 CCCTTGGATACCTGGGCCCTGGG - Intronic
1131833339 15:96368097-96368119 CACAGGGCTGGTTGGGTCCTCGG + Intergenic
1132145021 15:99424511-99424533 CCCATGGATGAAGGGGCCCTGGG + Intergenic
1133186410 16:4102351-4102373 CCCTTGAATGGTTGGGTGCTTGG - Intronic
1134507882 16:14822962-14822984 CCCATGTACCTCTGGGTCCTTGG - Intronic
1134695583 16:16221725-16221747 CCCATGTACCTCTGGGTCCTTGG - Exonic
1134976246 16:18572961-18572983 CCCATGTACCTCTGGGTCCTTGG + Intergenic
1135919348 16:26634618-26634640 CCTCTGGATGGCTGGGGCCATGG - Intergenic
1135965823 16:27034221-27034243 CCCATGCATGGGAGGGTCCCTGG - Intergenic
1136317295 16:29461761-29461783 CAGGTGCATGGCTGGGTCCTGGG + Exonic
1136431870 16:30201104-30201126 CAGGTGCATGGCTGGGTCCTGGG + Exonic
1139338605 16:66251531-66251553 CTCATGGATTGCTGGGTGGTAGG + Intergenic
1141463446 16:84191688-84191710 GCCACGGAGGGCTGGGTCCCAGG + Intronic
1141825191 16:86473677-86473699 CCCATGGCGGGCTGGGTGTTGGG + Intergenic
1142482926 17:229688-229710 GCCATGGATGAGTGGGTCCTGGG + Intronic
1142596624 17:1032825-1032847 CCCAGGGGTGTCTGGGGCCTCGG + Intronic
1142954001 17:3507936-3507958 CCCATGGATGGCACATTCCTAGG + Intronic
1143057869 17:4175936-4175958 CCCCAGGAAGGCGGGGTCCTTGG + Intronic
1143810626 17:9468713-9468735 CCCTGGGAAGGCCGGGTCCTTGG - Intronic
1148102971 17:45103947-45103969 CCCATGGGAGGCTGCGTCCCGGG - Intronic
1148832037 17:50440110-50440132 CCCATGGGAGGCTGGTCCCTAGG - Intronic
1148895741 17:50838045-50838067 TCCATGAAAGCCTGGGTCCTTGG - Intronic
1149561579 17:57611401-57611423 CTTTTGGCTGGCTGGGTCCTTGG - Intronic
1149604252 17:57913755-57913777 ACAATGCATGGCTGTGTCCTGGG + Intronic
1149640120 17:58197285-58197307 CCCAGGGATGGCTGTTTCCTGGG - Intronic
1150268890 17:63849761-63849783 CCCAAGGAAGGCAGGGCCCTTGG - Intergenic
1151786454 17:76277362-76277384 CCCATGGGTGGGTGAGTCCCAGG - Intronic
1152103855 17:78317824-78317846 CCCAGGGATGGCTGGGAGGTGGG + Intergenic
1152214686 17:79025207-79025229 GCCATGGAGGGCTGGGTGGTGGG - Intronic
1152324340 17:79626898-79626920 CCCATGGAAGCCTGGAGCCTCGG + Intergenic
1153681333 18:7503929-7503951 CCCATGGATGCCTGAAACCTTGG - Intergenic
1153822123 18:8841089-8841111 AGGATGGATGGCAGGGTCCTGGG - Intergenic
1155220776 18:23683731-23683753 CCCATGCATGTCTAGGTTCTTGG + Intergenic
1156702443 18:39841699-39841721 CTGATGGATCGCTGGGGCCTCGG + Intergenic
1160734017 19:653605-653627 CTCATGGATGGCTGGGCCCCTGG + Intronic
1160946836 19:1647638-1647660 CCCTTGGAGGTCTGGGTCCAGGG - Intronic
1161012502 19:1967462-1967484 GCCAGGGGTGGCTGGGGCCTGGG + Intronic
1161119536 19:2517851-2517873 CCCAAGGATACCTGGGACCTGGG + Intronic
1161962462 19:7530154-7530176 CACATGAATGGCCGGGTCCCGGG - Intronic
1163643050 19:18472696-18472718 ACCATGCAAGGCTGGGTTCTAGG - Intronic
1163748644 19:19062636-19062658 CCCAGGCATGGCTGTGTCATCGG - Intergenic
1164462289 19:28459216-28459238 CCCATGGAGGGTTGGGATCTGGG + Intergenic
1164527814 19:29024712-29024734 CCCCTGAAAGGCTGGATCCTTGG - Intergenic
1165978114 19:39694693-39694715 CCCATGGAGGGCTGGGTACTGGG - Intergenic
1166209002 19:41293649-41293671 CCCAGGGAAGGCTGTGTACTGGG - Intronic
1166995149 19:46716518-46716540 CCTGAGGATGGCGGGGTCCTGGG + Exonic
1167158358 19:47752694-47752716 CCCAGGGCTGTCTGGGTCATTGG - Intronic
1167311586 19:48740423-48740445 ACCCTGGATTCCTGGGTCCTGGG + Intronic
925911744 2:8578309-8578331 CCTTTGCATGGATGGGTCCTAGG + Intergenic
925985485 2:9211713-9211735 CCCATGGACGGCAGGGCCCCTGG - Intronic
927551420 2:24003529-24003551 CCCATGGAAGGCTGGGAGCTAGG - Exonic
927974364 2:27326846-27326868 CCTATGGATGGCTGGTATCTGGG - Exonic
932618713 2:73252878-73252900 CACATGGCTGGCTGGCTGCTGGG + Exonic
935439541 2:103076144-103076166 CCCTTGGATGTCTGGCTGCTAGG - Intergenic
938762527 2:134438764-134438786 CCCAGGGCTGTATGGGTCCTGGG + Intronic
944496493 2:200312300-200312322 CCCACAGATGGCTGGCTGCTTGG - Intronic
944731300 2:202520579-202520601 CCCATAAATGGTAGGGTCCTTGG - Intronic
945289424 2:208112618-208112640 CCCATGGCTGGCTGGGCGCACGG + Intergenic
945290717 2:208124469-208124491 CCCATGGCTGGCTGGGCGCACGG + Exonic
946388317 2:219399796-219399818 CTCATGGAAGGCTGGTGCCTAGG + Intronic
947476082 2:230448862-230448884 CCCCTGGATGACAGGGGCCTTGG - Intronic
947714290 2:232332070-232332092 CCCAGGGATGGCTGGGCCTGTGG + Intronic
947733498 2:232443449-232443471 CCCAGGGATGGCTGGGCCTGTGG + Intergenic
947915839 2:233831118-233831140 CCCATGGAGGGCTGGGTCCCAGG + Intronic
948830303 2:240595355-240595377 CCCATGGAGGTCTGGGTTCTAGG + Intronic
948835718 2:240625117-240625139 CCCTGGGAGGGCTGGGCCCTGGG + Intronic
949021691 2:241744453-241744475 TCCAGAGGTGGCTGGGTCCTGGG + Intronic
949035492 2:241814134-241814156 CACATGGCTGGCAGGGTCCCGGG + Intronic
1168914851 20:1477265-1477287 GCCATGAATGGCTTGGTCATGGG - Intronic
1169241421 20:3984343-3984365 GCCAGGGATGACTAGGTCCTGGG - Intronic
1169545466 20:6645601-6645623 CTCATGTATGCCAGGGTCCTGGG + Intergenic
1169916214 20:10686523-10686545 CCCATGTGTGTCTGGGTACTGGG - Intergenic
1170243277 20:14193574-14193596 CCCATTGATCCCTAGGTCCTAGG - Intronic
1170607347 20:17883912-17883934 CCCCTGGAAGGCTGAGCCCTAGG + Intergenic
1170957239 20:20992232-20992254 CTCATGGATAGGTGGGCCCTTGG + Intergenic
1172770908 20:37382071-37382093 CCCCTGACTGGCTGGGTCCTCGG - Intronic
1173096565 20:40035842-40035864 CAGATGGATTGCTGGGTCATGGG - Intergenic
1175190738 20:57210783-57210805 ACCCTGGATGGCTGGGCCCAGGG - Intronic
1176081824 20:63277277-63277299 ACCATGGACGGCAGCGTCCTGGG - Exonic
1176107285 20:63395469-63395491 CCCAAGCTTGGCTGAGTCCTTGG - Intergenic
1176261379 20:64182659-64182681 GCCAGGGAGGGCTGGGTCCAGGG - Intronic
1178910175 21:36667763-36667785 CCCATTGAGGGCTGGGTGCATGG + Intergenic
1179099426 21:38343781-38343803 CCCAGGGCTGGCTGGGTCAGGGG - Intergenic
1180080250 21:45483390-45483412 CCGAAGGAAGGCTGGGTCCATGG - Intronic
1180781593 22:18523207-18523229 CCCAGGGCTGGCTGGGGGCTGGG + Intergenic
1180996631 22:19969134-19969156 CCCCTAGCTGGCTGGGTTCTGGG + Exonic
1181238477 22:21462550-21462572 CCCAGGGCTGGCTGGGGGCTGGG + Intergenic
1182091324 22:27596875-27596897 CCCATGGAGGGCTGTTTGCTGGG - Intergenic
1183089073 22:35508985-35509007 CCCATGCCTGGCCAGGTCCTAGG + Intergenic
1184285746 22:43470454-43470476 CACATGGATGGATGGGTACATGG - Intronic
1184378836 22:44132294-44132316 CTCGTGGGTGGCTGGGTCCGTGG + Intronic
1184560723 22:45261486-45261508 GCCCTTGATGGCTGGGTTCTGGG + Intergenic
1184592855 22:45496796-45496818 CCCTTTGATCCCTGGGTCCTGGG - Intergenic
1184643415 22:45883941-45883963 CCCAGGGAGGGGTGGGTCCGAGG - Intergenic
1184947801 22:47816545-47816567 CCGTTGCAAGGCTGGGTCCTGGG + Intergenic
1185270444 22:49927117-49927139 CCCTTGGATGGCTGCGTCCGGGG + Intronic
949409668 3:3749795-3749817 CCTATAGATAGCTTGGTCCTGGG - Intronic
950117361 3:10460079-10460101 ACCATGGAGGGCTGGGGCCTAGG + Intronic
954006402 3:47594764-47594786 CACAAGGATGCCTGAGTCCTTGG - Intronic
959025493 3:101235901-101235923 ATCATAGCTGGCTGGGTCCTGGG + Intronic
961000647 3:123371849-123371871 CTCAGGGATAGCTGGGCCCTGGG + Intronic
961557519 3:127706808-127706830 CCCGTGGAAGGCTGTGTCCTGGG + Intronic
964202223 3:154130727-154130749 CCCATGGCTGGCTTGGTTCAGGG + Intronic
967230507 3:187333380-187333402 CCCACGGAGGGCTGTGTCCTAGG + Intergenic
967303553 3:188039527-188039549 CGCATGGATGACTGGATCCTTGG + Intergenic
967888008 3:194346260-194346282 CCCACGGAGGCCGGGGTCCTGGG + Intronic
968427201 4:531963-531985 ACCAGGGAGGGCTGGGTCCTGGG - Intronic
969414837 4:7051397-7051419 CCAATGTCTGGCTGGGTGCTGGG + Intronic
973636208 4:52863454-52863476 GCCATGGAGGGCTGGGGACTGGG - Intronic
977559602 4:98518919-98518941 CCCATGGCTTGCTGGTCCCTTGG - Intronic
983629719 4:169837705-169837727 CTCATGAATGGCTTGGGCCTTGG - Intergenic
984400424 4:179257220-179257242 CCCCAGTATGGCTGGGTCCAGGG + Intergenic
985387329 4:189461520-189461542 CCCATGGGTGCCTGGGTTGTAGG + Intergenic
985492545 5:187989-188011 GCCAGGGATGCCTGGATCCTGGG - Exonic
987025889 5:13926105-13926127 ACCATGGAGGGCAGGGACCTAGG + Intronic
989081802 5:37630564-37630586 CCCAAGGATGGATTTGTCCTAGG + Intronic
990982821 5:61617048-61617070 CCCCTGGATAGCTGGGGCTTTGG - Intergenic
992187394 5:74257419-74257441 CACATGGTGGGCTGGGACCTGGG - Intergenic
994757185 5:103808952-103808974 CCCATGAAGGGCTGGATTCTTGG + Intergenic
996044866 5:118860533-118860555 CCTAGGGATGGCTGGGTCAAAGG + Intronic
998003600 5:138642934-138642956 GCCAAGGCTGGCTGGGTCCTAGG + Intronic
998266015 5:140668430-140668452 AACATGGATGGCTTTGTCCTTGG - Exonic
998278751 5:140784021-140784043 CTCATGAATGGCTTGGTGCTTGG + Intergenic
999206459 5:149851784-149851806 CACATGCATGGATGTGTCCTTGG + Exonic
1000877203 5:166655583-166655605 TCCATGGAGGGATGGGCCCTTGG + Intergenic
1001397514 5:171427881-171427903 CACAGGGATGGGTGGGTTCTGGG + Intronic
1001929182 5:175660540-175660562 CCCATGGATGGTGGGGTTGTGGG + Intronic
1003071303 6:2947493-2947515 CTCCTGGATGGCTGGGTGCAGGG + Intergenic
1003666260 6:8114487-8114509 CCCATGCATGGCTTGCTTCTGGG + Intergenic
1004172970 6:13312917-13312939 CCCATGGTTGGTTGAGTCCATGG - Intronic
1004701946 6:18087618-18087640 CCCCTGCAGGGTTGGGTCCTGGG - Intergenic
1005997848 6:30942431-30942453 CCTGTGGATGGCTCTGTCCTTGG - Intronic
1006439364 6:34043590-34043612 CCCATGGCTGGGTGCGTCCTTGG - Intronic
1006463521 6:34177532-34177554 CCCAGGGAGGGCTGGCTGCTGGG - Intergenic
1007299241 6:40853840-40853862 GCCCTTGAGGGCTGGGTCCTGGG + Intergenic
1012703665 6:102495019-102495041 CCCAGGGATGCCTGAGTGCTGGG + Intergenic
1013981111 6:116130569-116130591 TGCCTGGATGTCTGGGTCCTAGG + Intronic
1014288560 6:119531479-119531501 CCTATGGATGTCTAGGTCATTGG - Intergenic
1019256763 7:57348-57370 ACCATGGCAGGCTGGGTGCTGGG + Intergenic
1020278413 7:6637806-6637828 CTCCTGGATGGGTGTGTCCTGGG - Intronic
1021078174 7:16330878-16330900 CACATGGAGGGCTGGGTGTTTGG - Intronic
1023752294 7:43384331-43384353 CCCATGGGTTGCTGGATCATGGG - Intronic
1024035909 7:45507032-45507054 CCCCTGGATGCCTGGCTCCCTGG + Intergenic
1024118700 7:46216227-46216249 GGCATGAATGGCTGGGACCTGGG + Intergenic
1024278487 7:47698374-47698396 CCCAGGGCAGGCTGGGACCTGGG + Intronic
1025085442 7:56019717-56019739 CCCATGGCTCGCCGTGTCCTAGG + Exonic
1026453923 7:70554527-70554549 CCCCTGGATGGCAGGGTATTTGG - Intronic
1026582508 7:71630087-71630109 CCCCTGGATGTCTGGATCCCAGG - Intronic
1027278770 7:76590536-76590558 CCCATGGGTGGAGGGGTCCTAGG - Intergenic
1029075227 7:97929238-97929260 CCCCTGCACGGCTGGGTCCCAGG - Intergenic
1034427834 7:151023917-151023939 CCCGTGGATGGGTGAGTCTTGGG + Exonic
1036242293 8:7091140-7091162 CCCCTGCACGGCTGGGTCCCAGG + Intergenic
1036258496 8:7222872-7222894 CCCCTGCACGGCTGGGTCCCAGG - Intergenic
1036307070 8:7610508-7610530 CCCCTGCACGGCTGGGTCCCAGG + Intergenic
1036310551 8:7681468-7681490 CCCCTGCACGGCTGGGTCCCAGG - Intergenic
1036357917 8:8058495-8058517 CCCCTGCACGGCTGGGTCCCAGG + Intergenic
1036893031 8:12608451-12608473 CCCCTGCACGGCTGGGTCCCAGG - Intergenic
1036899525 8:12660290-12660312 CCCCTGCACGGCTGGGTCCCAGG - Intergenic
1036900589 8:12666437-12666459 CCCCTGCACGGCTGGGTCCCAGG - Intergenic
1037316676 8:17605853-17605875 CTCTTTGATGGCTGGCTCCTCGG + Intronic
1037400936 8:18494630-18494652 CCCATGAAGTGCTGAGTCCTGGG + Intergenic
1038562969 8:28596491-28596513 CCCCTGTGTGGCTGGGTCCGAGG + Intergenic
1039212965 8:35236423-35236445 TCCAGGGCTGGCTGGGACCTCGG - Intronic
1039972380 8:42331202-42331224 CCCACGGAGGGCTGCGTCCTGGG - Exonic
1041277214 8:56174728-56174750 TCCATGGTTGGCTGAGTCCATGG - Intronic
1047501565 8:125445748-125445770 GCCATGGATTGGTGGCTCCTGGG - Intergenic
1048017548 8:130511177-130511199 CCCAGGGATGGCTACCTCCTGGG + Intergenic
1049619138 8:143589929-143589951 CCCATTCATGGCTGGCCCCTCGG + Exonic
1050269176 9:3923998-3924020 CCCATGGATGGCTGTGTTTTAGG - Intronic
1053002732 9:34586182-34586204 CCCAGGGCTGGCTGCATCCTAGG + Intronic
1053537484 9:38939671-38939693 CTCATGGATGTCTTGGTGCTGGG + Intergenic
1054628651 9:67424259-67424281 CTCATGGATGTCTTGGTGCTGGG - Intergenic
1057217648 9:93238329-93238351 CCCCTGAAGGGCTGGGTTCTGGG + Intronic
1058601161 9:106671902-106671924 CCCATGTTTGGCTGGGTGATTGG + Intergenic
1058915517 9:109560789-109560811 TCCAGGCATGGCTGGGACCTGGG + Intergenic
1059452474 9:114379098-114379120 CACCTGCATGGCTGGGGCCTGGG - Intronic
1059884466 9:118730123-118730145 CCCATTCATGGCTGGGTTGTAGG - Intergenic
1062454947 9:136631652-136631674 ACCATGGATGTCTGGGGCCGAGG + Intergenic
1062634662 9:137484550-137484572 CCCAAGGATGGCTGGAGGCTGGG + Intronic
1187018689 X:15357333-15357355 CCCATGGAGGGCAGCGTCCTGGG - Intronic
1189037135 X:37505159-37505181 CCAGTGGAGGGCAGGGTCCTCGG - Intronic
1190054965 X:47175988-47176010 CCCATGGATGGCTGGGTCCTGGG - Intronic
1197167216 X:123391672-123391694 CGGATGGGTGGGTGGGTCCTTGG + Intronic
1199982203 X:152927405-152927427 GCCATGGAGGGCTGGGTCAGCGG - Intronic