ID: 1190056090

View in Genome Browser
Species Human (GRCh38)
Location X:47181802-47181824
Sequence GTGGGAGAGCAGAACTAGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 337}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190056090_1190056096 1 Left 1190056090 X:47181802-47181824 CCATCCTAGTTCTGCTCTCCCAC 0: 1
1: 0
2: 2
3: 34
4: 337
Right 1190056096 X:47181826-47181848 GGCTACCAGCCCCACTGCCCAGG 0: 1
1: 1
2: 1
3: 25
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190056090 Original CRISPR GTGGGAGAGCAGAACTAGGA TGG (reversed) Exonic
901354307 1:8630265-8630287 TTGGGAGACTAGAACTGGGAGGG - Intronic
901499168 1:9641009-9641031 GGGGGACTACAGAACTAGGAAGG - Intergenic
901535162 1:9877960-9877982 GTGGCTGGGCAGAAGTAGGAAGG + Exonic
902935212 1:19760043-19760065 CTGGGGGAGCAGGACTTGGAGGG - Intronic
903654315 1:24939796-24939818 GTGGGAGGGGAGAAGTGGGAGGG + Intronic
904044804 1:27602949-27602971 GTGGGAGCGGAGAACAAGGCTGG - Intronic
905237817 1:36562181-36562203 GAGGAAGAGCAGAAGGAGGAAGG - Intergenic
905494638 1:38375171-38375193 GTGGGAAAGAAGAACTTGAATGG - Intergenic
905543410 1:38778411-38778433 GTGGGAGAACAGAGGTAGGTAGG - Intergenic
906280407 1:44549598-44549620 ATGGGGAAGCAGAACTGGGAGGG - Intronic
907386818 1:54131170-54131192 GTGGGAGAGCAGAACTGCGGAGG - Intergenic
907676887 1:56526148-56526170 CTGAGAGAGCAAAACTAGTATGG + Intronic
908101543 1:60796349-60796371 GAGGTAGAGCTGGACTAGGAAGG + Intergenic
908903776 1:68985231-68985253 GTGGGAGAGCAGAAGCAGGGTGG + Intergenic
908936302 1:69381195-69381217 GTGGTAGAGTAGAAGTGGGATGG - Intergenic
909586813 1:77299531-77299553 GTGGGAGAGGAAACCTAAGAAGG - Intronic
911097231 1:94064718-94064740 GTGTGACAGCAGCACTAGAAAGG + Intronic
911117497 1:94260990-94261012 ATGGGGGTGCAGAATTAGGAAGG - Intronic
911530626 1:99039398-99039420 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
911767059 1:101690237-101690259 CTGGGAGAGCAGAACAGAGAAGG + Intergenic
912333472 1:108841283-108841305 GTTGGAGAGCAGACTAAGGAAGG + Intronic
912876967 1:113370227-113370249 GGGGGAGAGGAGAACCATGAGGG + Intergenic
913378583 1:118184495-118184517 GTGGGAGATCAGAGCAATGAGGG - Intronic
913703597 1:121397104-121397126 GTGGGAGAGAAGAAGGAGGGCGG + Intergenic
914338455 1:146738285-146738307 GAAGGAGAGCAGAATCAGGAAGG - Intergenic
915440905 1:155944967-155944989 GTGGGGGAGTGGAACGAGGAGGG + Intergenic
915713043 1:157919613-157919635 GTGGGGAAGCAGAAGCAGGAGGG - Intergenic
917415652 1:174806651-174806673 GTGAGATAGTAGCACTAGGATGG + Intronic
918128083 1:181601855-181601877 GTGGAAGAGCAGATCATGGAGGG - Intronic
918364700 1:183795446-183795468 GTGGGAGAGGAGAACAGGGAAGG + Intronic
918554022 1:185777939-185777961 GGGGGAGAGCAGAACTTGAAAGG + Intronic
919178221 1:194047272-194047294 GTGGGAAAACAGAAACAGGAGGG + Intergenic
919404791 1:197165941-197165963 GGGGGCGAGCAGAACCAGGGTGG + Intronic
920015143 1:202901110-202901132 GTGGGAGAAAAGAAGTAGAAAGG + Intronic
920133739 1:203753200-203753222 GTGGGGGACCAGAACAGGGAAGG - Intergenic
920916751 1:210263869-210263891 GTGGTAAAGCAGGAGTAGGAAGG + Intergenic
921932538 1:220766349-220766371 GTGGGAAACTAGAACTGGGAGGG - Intronic
922405629 1:225309869-225309891 GTGAGAGAGCAAGACTCGGAGGG + Intronic
922590962 1:226776217-226776239 GTAGGAGAGCTGAAGCAGGAAGG - Intergenic
924290345 1:242529818-242529840 GAGGGAGAGAAGAAGAAGGAAGG - Intergenic
1063502338 10:6566564-6566586 CTGGCAGAGCAGGACTAGGTAGG + Intronic
1064129959 10:12700692-12700714 GTAGGAGAGCTGAAGCAGGAAGG + Intronic
1065508787 10:26456872-26456894 GTGGAAGACCTGTACTAGGATGG + Intronic
1066638996 10:37536796-37536818 GTGGGAGATCAGACTTTGGATGG - Intergenic
1067068699 10:43117552-43117574 GTGGGACAGCTGACCTGGGAGGG + Intronic
1069120899 10:64567792-64567814 GAGGGTGAGCAGAAGTAGGGAGG - Intergenic
1069422700 10:68261117-68261139 ATGGCTGAGCAGAACTAGGAGGG + Intergenic
1070747230 10:78941479-78941501 GAGGGATACCTGAACTAGGAAGG + Intergenic
1070795144 10:79211866-79211888 GTGGGAGAGCAGGTCCAGGAGGG + Intronic
1071508308 10:86246080-86246102 CTGGGAGAGCAGAGCTGGGAAGG - Intronic
1071688971 10:87795216-87795238 TTGGGAGAGCAGAACATGGCTGG + Intronic
1072002635 10:91211912-91211934 GTGGTTGAGCAGCACTAGAATGG + Intronic
1072404324 10:95136032-95136054 GAGGGAGAGCAGAAGCAGGGTGG + Intergenic
1072686803 10:97542430-97542452 GTGGGAGAGCAGAGGGAGGGAGG - Intronic
1073445218 10:103576356-103576378 GTAGGGGAGCAGATCCAGGAGGG + Intronic
1074936813 10:118190157-118190179 GTGGGAGAGAAAAAGTAAGAAGG + Intergenic
1077305253 11:1866026-1866048 GTGGGAGAGCAGAGTTTGGAGGG + Intronic
1077758562 11:5064687-5064709 GGAGGAGGGCAGAGCTAGGAGGG - Intergenic
1082670624 11:56032970-56032992 GTGGGTGAGCAGAAGCAGGGTGG + Intergenic
1083808659 11:65089923-65089945 GTGAGAGATGAGAACTAGGCTGG + Intronic
1087452400 11:98341978-98342000 GTGGGAGAGGAAAAGTAAGAGGG - Intergenic
1087793028 11:102427415-102427437 GTGGGAGAGAAGAAATAGGGAGG + Intronic
1088220227 11:107562844-107562866 GGGGGAGAGGAGAAAGAGGAAGG + Intronic
1088830086 11:113529565-113529587 GTGAAAGAGCAGTACTGGGAGGG - Intergenic
1088832108 11:113546218-113546240 GTGCGACAGCAAAACTAGCATGG - Intergenic
1089103296 11:115982152-115982174 GTGGGAGAGCAAAGTGAGGATGG - Intergenic
1090252246 11:125259833-125259855 GTGGGATGGCAGAGTTAGGATGG - Intronic
1090286176 11:125501425-125501447 GTGGTAGAGCAGACATTGGATGG - Intergenic
1090912324 11:131132120-131132142 GTGTGGGAGCAGACCTAGAAAGG - Intergenic
1091386418 12:98856-98878 GAGGGCGTGCAGAAGTAGGAAGG + Intronic
1091858533 12:3758245-3758267 ATGGGAAAGCAGAATTATGAGGG - Intronic
1092736783 12:11590266-11590288 ATGGGAGAGAAGAATGAGGATGG + Intergenic
1092984337 12:13831092-13831114 GTGGGAGAGCGGAAGCAGGAAGG - Intronic
1099277386 12:80594345-80594367 GTGGCAGTGCAGTATTAGGATGG + Intronic
1099600388 12:84728279-84728301 GTGGAAGTGCAGAACAAGCAAGG - Intergenic
1102028841 12:109728473-109728495 GTGGGAGAGCAGAGCCATGCAGG + Intronic
1103332001 12:120160607-120160629 GTGGGAGAGCTTATGTAGGAAGG - Intronic
1103793796 12:123489840-123489862 GTGGGCCAGCAGCACTGGGATGG - Intronic
1103993647 12:124815320-124815342 GGGGGAGAGCAGAACGAGGCCGG - Intronic
1105926247 13:25011422-25011444 CTGGGAGCAGAGAACTAGGAAGG + Intergenic
1106038737 13:26069555-26069577 CTGGGAGCAGAGAACTAGGAAGG - Intergenic
1107277984 13:38698634-38698656 GTGAGAGAGCAGAGAGAGGAAGG + Intronic
1107473538 13:40713148-40713170 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1107566069 13:41605991-41606013 GTGGGAGAGAAGCACTTGCAGGG - Intronic
1108367186 13:49727588-49727610 GTAGCAGAGAAGAACTATGAGGG + Intronic
1109188851 13:59301731-59301753 TGTGGAGAGCAGAACTAGAATGG - Intergenic
1109427207 13:62180580-62180602 GTCTGAGAGCAGAGCTAGGCAGG - Intergenic
1110560837 13:76909364-76909386 GTGAGACAGCAGAATTATGAGGG - Intergenic
1110968689 13:81733369-81733391 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1113222699 13:108123238-108123260 GAGGGAGAGCAGATGGAGGAAGG + Intergenic
1113423164 13:110185746-110185768 GTGGGAGAGGAGAACGACGAGGG + Intronic
1114391667 14:22315439-22315461 GTGAGAGAGCAGAACTGCTACGG - Intergenic
1114517091 14:23307157-23307179 GGGGGAGATCAGAACCAGGAGGG - Exonic
1114558678 14:23576633-23576655 GTGGGAGAGCAGAGTGAAGACGG + Intronic
1114657595 14:24325406-24325428 GTTGGAGAGAAAAACCAGGAAGG + Exonic
1115709394 14:36033616-36033638 GTGGGAGAAGAGAACTTGGGCGG + Intergenic
1117104184 14:52381982-52382004 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1118379338 14:65204875-65204897 GCAGGAGAGCAGAGCTGGGAAGG + Intergenic
1119183222 14:72618383-72618405 GTGGGACTGAAGAACCAGGAAGG - Intergenic
1119200349 14:72747366-72747388 GTGGCAGAGAAGACCTAGGAAGG - Intronic
1119917427 14:78414898-78414920 GTGGGAGAGGAGAGCAAGGGAGG + Intronic
1120137195 14:80884503-80884525 GTGGATGAGCAGAAGTAGGGTGG + Intronic
1121709477 14:96026938-96026960 GAGGGAGGGCAGAACTGGAAGGG + Intergenic
1121958016 14:98231604-98231626 GTAGAAGAACTGAACTAGGAAGG + Intergenic
1124443492 15:29707462-29707484 GTGGATGTGCAGAGCTAGGAAGG + Intronic
1127299639 15:57640020-57640042 GTGGGAGAAGAGAACGAGGAAGG - Intronic
1127452608 15:59131474-59131496 GAGGGCGAGCAGAAGTAGGGTGG + Intergenic
1129153851 15:73705320-73705342 GGGTGAGATCAGAACTTGGATGG - Intronic
1131506538 15:93024925-93024947 GTGGGAGGCCAGAACTAGGCTGG - Exonic
1132080555 15:98861355-98861377 GTGAAAGAGAAGGACTAGGAGGG - Intronic
1132271633 15:100531418-100531440 GTGGGAGTGAGGAACTCGGAGGG + Intronic
1134608154 16:15587246-15587268 CTCTGAGAGCAGAGCTAGGAGGG - Exonic
1135050985 16:19192896-19192918 GTGGGAAATCAGAATTAGGGAGG - Intronic
1136615480 16:31395759-31395781 GGGAGAGAGCAGACCCAGGAGGG + Intronic
1136854494 16:33643366-33643388 GTGGGGGAGCAGAGCCAGGGTGG - Intergenic
1137551200 16:49438720-49438742 GTGGGGGAGCAGAACTGAGAGGG + Intergenic
1138520919 16:57570427-57570449 GAGGGAAAGCAGCACCAGGAGGG - Exonic
1139395675 16:66636992-66637014 CTGGGAGAGCAGAATTCTGATGG + Intronic
1139927846 16:70501218-70501240 TTGGGCCAGCAGAGCTAGGAGGG - Intronic
1139995823 16:70979069-70979091 GAAGGAGAGCAGAATCAGGAAGG + Intronic
1140127055 16:72126140-72126162 GAGGGAGAGCAGAACTGTCAGGG + Intronic
1140730529 16:77852085-77852107 GGGGGAGAGGAGCACTAGTATGG - Intronic
1141021709 16:80502806-80502828 GTGGGAGAGGAGCACCTGGAAGG - Intergenic
1141416990 16:83883310-83883332 GTGTGAGAGAAGAACCAGCAGGG - Intergenic
1143312426 17:6003036-6003058 GTGAGAGAGAAAAATTAGGACGG + Intronic
1143881808 17:10035573-10035595 GTGGGAGAGCATATCCTGGAGGG + Intronic
1146283017 17:31557689-31557711 GTGGGAGCGCAGGATTAGAAGGG - Intergenic
1146465695 17:33084458-33084480 GTGGCAGAGCAGAAAGAGCATGG + Intronic
1148561579 17:48609817-48609839 GTGGAACAGGAGAACTAGAAAGG - Intronic
1148779423 17:50113087-50113109 GTGGGAGGCCAGGACTGGGAAGG - Intronic
1149434091 17:56618724-56618746 GTGGGAGAGCAGAGTGAGCATGG + Intergenic
1150195109 17:63289955-63289977 GTGGGAGAGGAGGACTAGAGTGG + Intronic
1150959885 17:69901537-69901559 GTGACAGAGCAGAATAAGGAGGG + Intergenic
1151055320 17:71023930-71023952 GTGGGAGTGCAGAAGGAGCACGG - Intergenic
1151185880 17:72363607-72363629 GTGGGGAAGCTGAGCTAGGAAGG - Intergenic
1151457487 17:74234695-74234717 GTGAGAGAGTAGAACTGTGAGGG + Intronic
1151873241 17:76850802-76850824 GTGAGAGAGTGGAACTAAGAGGG + Intergenic
1152054966 17:78017405-78017427 GTGGCGGAGCTGAACAAGGAGGG + Intronic
1152073096 17:78143820-78143842 GTGGGAGAGCCCACCTAGGTGGG + Intergenic
1152555721 17:81052287-81052309 GAGGGAAGGCAGGACTAGGAGGG - Intronic
1153717933 18:7869491-7869513 GAGGGAGAGCAGAAGCAGGGTGG - Intronic
1155161647 18:23201041-23201063 CAGGGAGAGCAGAAGCAGGAAGG + Intronic
1155171319 18:23268662-23268684 CTGGGGCAGCAGGACTAGGATGG + Intronic
1157802059 18:50628710-50628732 GTGGGAGAGGAGAGGTCGGAGGG - Intronic
1158367696 18:56757172-56757194 ATGGGAAAACAGAAGTAGGAAGG + Exonic
1158837726 18:61348730-61348752 GTAAGAGAGCACAACTAGCATGG + Intronic
1160239792 18:77114920-77114942 CAGGGAGAGCAGGAATAGGAAGG - Intronic
1160685120 19:431019-431041 CTGGGAGAGCAGAGCGGGGAAGG - Intronic
1160869784 19:1271923-1271945 GTGGCAGAGCAGAAGTAGACGGG + Intronic
1160937928 19:1606096-1606118 GTGGGAGAGCAGAGGAAGCAGGG - Intergenic
1161453298 19:4358345-4358367 GAGGGAGGGCAGAAGTTGGAGGG - Intronic
1162351090 19:10150196-10150218 GTGGCAGAGCAGAAGTGGGAGGG - Intronic
1162524931 19:11201604-11201626 GAGGGAGCCCAGATCTAGGAAGG - Intronic
1162554908 19:11380889-11380911 GTGGGAGAGCAGCGCGAGCACGG + Exonic
1163685141 19:18708332-18708354 GTTGGAGAGGAGAACAGGGAAGG + Intronic
1164331881 19:24267089-24267111 TGGGGAGAGTAGAACTAGGTTGG - Intergenic
1165254669 19:34568511-34568533 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1166120765 19:40684914-40684936 GTGGGAAATCAGACGTAGGAGGG + Intronic
1166193844 19:41193654-41193676 GTGGGGGACCAGGGCTAGGAGGG + Intronic
1167595130 19:50423503-50423525 GAGGGAGACCAGAGCCAGGAGGG + Intronic
1167781758 19:51602880-51602902 GTGGGAGGGGAGAATCAGGAAGG - Intergenic
1168130143 19:54312538-54312560 GAGGCAGAGCAGAACCATGAGGG + Exonic
1168326194 19:55539664-55539686 CTGTGGGAGCAGAACTGGGAAGG + Intergenic
1168473644 19:56660804-56660826 GTGGCAGAGCAGCAATAGGGAGG - Intergenic
925238231 2:2297730-2297752 CTGGGAGGGCAGAAGGAGGAGGG - Intronic
925532352 2:4877834-4877856 GTGTGAGAGGAGAACCTGGAAGG + Intergenic
926847988 2:17162943-17162965 GTGGTAGAGGAGGACTAGAATGG + Intergenic
927408890 2:22802910-22802932 GGAGGTGAGCAGAACTAGTAGGG - Intergenic
927520154 2:23693618-23693640 TAGGGAGAGCAGGACAAGGAAGG - Intronic
928058530 2:28084462-28084484 GTTTGAAAGCAGAACTTGGATGG + Intronic
929333625 2:40713249-40713271 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
929535834 2:42783664-42783686 GTGGGAGAGCAGGAAAAGGTAGG + Intronic
930298880 2:49589872-49589894 CTGGGAGAGCAGTAATAGGAAGG + Intergenic
930686372 2:54312785-54312807 GTGGGAGAGCAAAAGCATGATGG - Intergenic
931212171 2:60207609-60207631 GAGGGAGAGCAGAAGCAGGGTGG - Intergenic
932170896 2:69555113-69555135 GTGTGAGAGCTGAACAAGCATGG + Intronic
932688982 2:73896538-73896560 GTGGGAAAGGGGAACCAGGAGGG + Intronic
933739983 2:85525698-85525720 CTGGGAGAGGAAAACCAGGAGGG - Intergenic
935239034 2:101162199-101162221 ATGAGGGAGCAGAACTAGGCAGG + Intronic
935790508 2:106585775-106585797 GAGGGACAGGAGAACTGGGAGGG + Intergenic
937366328 2:121264509-121264531 CTGGGAGTGCAGAATCAGGAGGG + Intronic
938120879 2:128632265-128632287 GTGAGAGAGCAGGCCTGGGAAGG - Intergenic
940054624 2:149500507-149500529 GAGGGAGAGCAGAAGCAGGGTGG - Intergenic
941449219 2:165639277-165639299 GTAGGAGAGCTGAAATAGGAAGG + Intronic
941477963 2:165971643-165971665 GAGGGAGAGCAGAAGCAGGGTGG + Intergenic
942618819 2:177825391-177825413 GTGGGAGAGGAGAACAAGGAAGG + Intronic
943512237 2:188840464-188840486 GAGGGTGAGCTGAAGTAGGATGG + Intergenic
943633617 2:190281253-190281275 GTCAGAAAGCAGAGCTAGGAAGG - Intronic
944376800 2:199054747-199054769 GAGTCAGAGCAGAACTAGAAGGG + Intergenic
946818933 2:223610445-223610467 GTGGGAATGCAGAAGTATGAGGG - Intergenic
947353888 2:229272511-229272533 GTGGGAGAGGAGAACATGGTGGG + Intergenic
947364595 2:229381118-229381140 GAGGGCGAGCAGAAGCAGGATGG + Intronic
948263478 2:236621318-236621340 GAGGGGGAGCAGAACTCTGATGG + Intergenic
1169065120 20:2690829-2690851 GTCTGAGAGCAGAAGCAGGAAGG + Intergenic
1169208663 20:3753866-3753888 GTGGGAGAGGAGGACGAGGGAGG + Exonic
1170032400 20:11956817-11956839 GTGGGACAGCAGAGGCAGGAGGG - Intergenic
1171492848 20:25533252-25533274 GTGGGAGAGGAGAATAATGAAGG + Intronic
1172601878 20:36189665-36189687 GTGGTGCAGCAGAACTGGGAAGG - Intronic
1173551720 20:43937392-43937414 CTGGGAGAGGAGACCCAGGAGGG + Intronic
1174118592 20:48245436-48245458 AGGGGAGGGCAGAGCTAGGAAGG - Intergenic
1175056112 20:56199859-56199881 GATGGAGAGCAGATCTAGTAGGG - Intergenic
1175494939 20:59407527-59407549 TGGAGAGAGCAGAGCTAGGAAGG - Intergenic
1175574384 20:60049894-60049916 GTGGGAGGGCAGAGAAAGGAAGG - Intergenic
1177042787 21:16133485-16133507 GTGGGTGAGCAGAAGCAGGGTGG - Intergenic
1177730654 21:25024171-25024193 GTGTGAGAGCAGCAGTGGGAGGG - Intergenic
1178638615 21:34327635-34327657 GGTGGAGAGCAGCAATAGGAAGG - Intergenic
1178748297 21:35274969-35274991 GAGGGAGAGCAGAAGGAGGTGGG - Intronic
1179130943 21:38636668-38636690 GTGGGAGAGGAGAGGTTGGATGG - Intronic
1179272984 21:39865914-39865936 GTGGGAGAGAAGGAGGAGGAGGG - Intergenic
1179894548 21:44354002-44354024 TTGGGAGAACAGAACTGGGGAGG + Intronic
1180716958 22:17878324-17878346 GTGGGAGAGCAGCCCCAGAAAGG + Intronic
1181307083 22:21923037-21923059 GAGGGAGAGAAGGACAAGGATGG + Exonic
1182551665 22:31104105-31104127 GCGGGGGAGCAGAGCTAGGCAGG - Intronic
1185274965 22:49946784-49946806 AGGGGAGGGCAGAACTAGAAGGG + Intergenic
951629196 3:24699764-24699786 GAGGGAGAGCAGAAGCAGGGTGG - Intergenic
954573882 3:51664018-51664040 GAGGGAGGGAAGAACTAAGAGGG + Exonic
955503931 3:59612497-59612519 GTGGGAGTCAAGAAGTAGGAGGG - Intergenic
956211839 3:66809611-66809633 GAGAAAGAGCAGAACAAGGAGGG + Intergenic
957850514 3:85800702-85800724 GAGGGCGAGCAGAAGTAGGGTGG - Intronic
961345379 3:126260439-126260461 GAGGGAGAGGAGGACAAGGAGGG - Intergenic
961345395 3:126260498-126260520 GAGGGAGAGGAGGACAAGGAGGG - Intergenic
961820219 3:129572050-129572072 GCGGGAGAGAAGACCTGGGAAGG - Intronic
961986426 3:131139618-131139640 GTGGGAGAGCAGGAGAAGGGAGG + Intronic
962319829 3:134381476-134381498 TTGGGAGAGCAGAATGAGGAGGG + Intergenic
962365038 3:134773163-134773185 ATGGGGGAGGAGAACCAGGAAGG - Intronic
962417525 3:135196720-135196742 GTGGGAAAGGAGAAGTTGGAGGG - Intronic
962710688 3:138083306-138083328 GTGGGAAAGCACAAATAGCAAGG + Intronic
963091217 3:141485939-141485961 CTGGGAGATAAGAAATAGGACGG - Intergenic
964818680 3:160745646-160745668 GTGGGAGAGCAGGCTTGGGAAGG + Intergenic
965511024 3:169568065-169568087 GAGGGTGAGCAGAAGCAGGATGG + Intronic
967715503 3:192757902-192757924 GAGGGAGAGCAGAAGCAGGGTGG + Intronic
967864927 3:194182255-194182277 GAAGAAGAGCAGAAGTAGGAGGG - Intergenic
968081492 3:195849564-195849586 GTGGGAGGGCAGGGGTAGGAAGG + Intergenic
968606658 4:1538511-1538533 GTGGGAGGGCAGAGGTGGGAGGG + Intergenic
971985084 4:33811596-33811618 GTGGGAGAGTACAAATATGATGG + Intergenic
972149278 4:36068255-36068277 GTGCAAGAGCAGAACTTGAAAGG - Exonic
972260945 4:37407878-37407900 GAGGGCGAGCAGAAGCAGGATGG + Intronic
975071190 4:70140814-70140836 GTGGGAGAGCACAATTGGAAAGG + Intronic
975466418 4:74714252-74714274 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
976160316 4:82191820-82191842 GTGGGAGATGGGAACTGGGAGGG - Intergenic
976822765 4:89225557-89225579 ATGGGAGAACAGAATTTGGAGGG + Intergenic
977279500 4:95022030-95022052 TTGGGAGAGAAGAAATAGGACGG + Intronic
977618826 4:99113763-99113785 TCCAGAGAGCAGAACTAGGAAGG + Intergenic
978664213 4:111163875-111163897 GAGGGAGAGCGGAAGTAGGGAGG + Intergenic
979012248 4:115387092-115387114 GAGGGTGAGCAGAAGTAGGGTGG + Intergenic
979344272 4:119568058-119568080 CTAGGATAGCAGAACAAGGAAGG + Intronic
979871132 4:125823528-125823550 GTGAGAGAGCAGAGCAAGAAGGG + Intergenic
979969395 4:127115152-127115174 TTATGAGAGCAGAACTGGGAGGG - Intergenic
980369752 4:131852205-131852227 TTGGGAGAGCATAACAAGTAAGG - Intergenic
981486662 4:145294165-145294187 GTCTGAGAGCAGGAGTAGGAAGG - Intergenic
982825655 4:160001498-160001520 GAGGGTGAGCAGAAGTAGGGTGG + Intergenic
983306423 4:165995175-165995197 GTGGGTAAGTAGAACTAGGTAGG + Exonic
983596390 4:169472430-169472452 GAGGGAGAGCAGAAGCAGGGTGG - Intronic
984151477 4:176138365-176138387 GTGGGGGAGCAGGACTACTAAGG - Intronic
985475508 5:76739-76761 ATGGGAGAGGAGGCCTAGGAGGG + Intergenic
987754397 5:22082144-22082166 GTGGGACAGCAAAACTAGAAGGG + Intronic
988831725 5:34994337-34994359 TGGGGAGAGCAGAAAAAGGAAGG + Intergenic
989748830 5:44866297-44866319 ATGGGAGAGCAGAGGAAGGAGGG - Intergenic
990160161 5:52929233-52929255 CTGAGATAGCAGAACCAGGAAGG + Intronic
990424944 5:55678002-55678024 GTGGTAAAGTAGAGCTAGGAGGG + Intronic
991454100 5:66784000-66784022 GTGGGAGGGCAGAACAAAGCAGG - Intronic
992754151 5:79888747-79888769 GTGGGAAAGGAGAGCTTGGAAGG - Intergenic
992869033 5:80987582-80987604 GTGGGAGAGCAGACAAGGGAGGG + Intronic
993428048 5:87795098-87795120 GTAGAAGATCAGAACTGGGAGGG - Intergenic
995274203 5:110259629-110259651 CAGGGAGAGCAGATTTAGGATGG + Intergenic
995551683 5:113287958-113287980 GTAGGTGATCAGAACTGGGATGG - Intronic
996910963 5:128656268-128656290 GAGGGGGAGCAGAAGCAGGATGG - Intronic
997358437 5:133279386-133279408 GTGGGGGAGCAGAACAGAGATGG - Intronic
997530213 5:134577252-134577274 CTGGGAGAGTAGGACAAGGATGG - Intronic
997791977 5:136769702-136769724 GTGGGGCAGCAGAGCTAGGCTGG + Intergenic
998605447 5:143629342-143629364 GTGAGAGAGAAGAGCTAGGAAGG + Intergenic
998934070 5:147215870-147215892 TTGGGAGAGAAGGGCTAGGAAGG + Intergenic
999108370 5:149093704-149093726 GTGGGGGAGCAGAGCAAGGCTGG - Intergenic
1000052024 5:157571682-157571704 GAGTGAGAGCAGAAGCAGGAAGG + Intronic
1000155965 5:158552078-158552100 GTTGGAGAGGAGAATCAGGAGGG + Intergenic
1000194858 5:158947487-158947509 GAGGGCGAGCAGAAGCAGGACGG - Intronic
1002070073 5:176673951-176673973 GTGTCAGAGCAGAAGTGGGAAGG + Intergenic
1003637109 6:7842397-7842419 GTGGGAGAGGAGAACAGAGATGG - Intronic
1003684630 6:8289612-8289634 GAGAGAGAGCAGAAATTGGAAGG - Intergenic
1003728355 6:8792035-8792057 GTGGGAGAGCTGGAAGAGGAGGG + Intergenic
1004064759 6:12233203-12233225 GTAGGAGGACAGAGCTAGGAAGG - Intergenic
1004097369 6:12570809-12570831 GTGTGAGAGCAGGAGGAGGAAGG + Intergenic
1004171168 6:13296567-13296589 TAGGGAGACCTGAACTAGGATGG - Intronic
1004757123 6:18622557-18622579 GTGGTAGAACACAATTAGGAAGG + Intergenic
1005345331 6:24883869-24883891 GTGGGGGAGCATAAACAGGATGG - Intronic
1005385554 6:25280664-25280686 ATGGCAGAGCTGAAATAGGATGG + Intronic
1006517548 6:34553229-34553251 GTGGGAGAGCAGAATCTGGCAGG + Intronic
1007409248 6:41652315-41652337 GTGGGAGAAGAGAACTAAGAGGG + Intronic
1007458254 6:41997587-41997609 GTGGGAGCTCAAAACCAGGAAGG + Intronic
1007463018 6:42031630-42031652 TTGGGGGAGCAGAACTAAAAGGG - Intronic
1007681920 6:43639980-43640002 GTGGGAGAGAAGAACAAGGCAGG - Intronic
1007811182 6:44486861-44486883 ATGGGAGCCCAGAACAAGGAGGG - Intergenic
1007955213 6:45911887-45911909 TTGGGAGATGAGAACTAGGAGGG + Intronic
1009421970 6:63473543-63473565 GTGGGAGAGCAGGACTGGTGTGG - Intergenic
1010355681 6:74930024-74930046 GAGGAAGAGGAGAAGTAGGAAGG + Intergenic
1010510956 6:76718958-76718980 GTGAGAGAGCAGAGTTATGAAGG + Intergenic
1010952213 6:82050155-82050177 GAGAAAGAGCAGAAGTAGGAAGG - Intergenic
1010995861 6:82531677-82531699 GTGGGAGAAAAGAAGGAGGATGG + Intergenic
1012992544 6:105940505-105940527 GTCTGTGAGTAGAACTAGGAAGG - Intergenic
1013452903 6:110303008-110303030 GAGGGCGAGCAGAAGTAGGGTGG + Intronic
1014214281 6:118737661-118737683 GAGAAAGAGGAGAACTAGGAGGG + Intergenic
1015638521 6:135304854-135304876 GTGGGGCAGCATAATTAGGAGGG + Intronic
1015916724 6:138225006-138225028 GTGGGAGGGCAGTGGTAGGATGG + Intronic
1017103482 6:150867062-150867084 ATGGGAGAGCAGAGGGAGGAAGG - Intronic
1018377122 6:163223511-163223533 ATGGGAAAGCAGAAGAAGGATGG + Intronic
1018576999 6:165269205-165269227 CTTGGAGAGCAGATCTACGAGGG + Intergenic
1019038062 6:169078611-169078633 GTGGGACAACACAACTAGGAGGG + Intergenic
1020262147 7:6536554-6536576 GTGGGAGAGGAGAACCGAGAGGG + Intronic
1020357575 7:7293750-7293772 GTTGGTGAGCAGAAATAGTATGG + Intergenic
1023051841 7:36259139-36259161 GAGGGCGAGCTGAACCAGGATGG - Intronic
1023561746 7:41481262-41481284 GTGGGAGAGCAGAAATATTATGG - Intergenic
1024896880 7:54270562-54270584 GTGGGAAAGTAGAACTGGGGAGG + Intergenic
1027219881 7:76206985-76207007 GAGGGAGTGCTGGACTAGGAGGG - Intronic
1029262776 7:99314625-99314647 GTGGGAGAGCAGGAGGAGGTAGG + Intergenic
1029408176 7:100390334-100390356 CTGAGAGAGAAGAACTAGGGGGG - Intronic
1029409638 7:100400630-100400652 GATGAAGAGCAGAACCAGGATGG + Intergenic
1029420633 7:100469996-100470018 GTGGGAGAGGAGAAGTTGAAGGG + Intronic
1031443116 7:121817382-121817404 ATTGGAGAGGAGAAATAGGATGG + Intergenic
1033740946 7:144275362-144275384 GGGGGTGAGAAGAACTAGGTGGG + Intergenic
1033752960 7:144374251-144374273 GGGGGTGAGAAGAACTAGGTGGG - Intronic
1034224189 7:149470136-149470158 GTGGATGAGGAGAACAAGGAAGG + Intergenic
1034254365 7:149716178-149716200 CTGGGAGAGCAGGTCTAGGTTGG + Intronic
1034680478 7:152924546-152924568 GAGGGAAAGCAGAACTTGGGGGG + Intergenic
1037719563 8:21431198-21431220 GTGGGTGAGCAGAATCAGGGTGG + Intergenic
1037942151 8:22959711-22959733 GGGGTAGAGCAGAGCTGGGATGG - Intronic
1039413604 8:37375531-37375553 GTCAGAGAACAGAGCTAGGAGGG - Intergenic
1039597001 8:38799137-38799159 GTGGGGGAGGAGAGCTGGGAGGG + Intronic
1042953065 8:74220733-74220755 GTGGGAAAGGAGACCTGGGAGGG + Intergenic
1045491282 8:102671278-102671300 GTGGGAGAGGAGAAGTGGGCTGG - Intergenic
1045508275 8:102794207-102794229 GTGGTAGGGGAGACCTAGGAAGG + Intergenic
1046776010 8:118164114-118164136 GAGGGAGAGCAGCAGGAGGAAGG + Intergenic
1047628953 8:126684812-126684834 GTGGGAGAACAGAAACAGGATGG - Intergenic
1048553428 8:135454804-135454826 CTGGGAAGGCAGAACCAGGAAGG + Intergenic
1048557629 8:135496138-135496160 ATGAGAAAGCAGAAGTAGGAAGG + Intronic
1049802278 8:144523412-144523434 GTGGGAGAGCAGCGTTAGGCAGG + Exonic
1049982296 9:915532-915554 GGGGCAGAGCAAAACTCGGAAGG - Intronic
1050337087 9:4599977-4599999 GTGAGGGAGCAGGAATAGGAAGG - Intronic
1052366278 9:27615214-27615236 GAGGGTGAGCAGAAGTAGGGTGG - Intergenic
1052506284 9:29358808-29358830 GAGGGTGAGCAGAAGTAGGGTGG + Intergenic
1052684236 9:31733936-31733958 CTGAGAGTTCAGAACTAGGAAGG + Intergenic
1053484748 9:38443259-38443281 CTGGGAGAGGAGAAGTGGGAGGG + Intergenic
1055438673 9:76317892-76317914 GTGGGGAAGCAGATCTAGGCTGG - Intronic
1055815126 9:80195862-80195884 GTTGGAAGGCAGAACAAGGAAGG - Intergenic
1055823970 9:80301562-80301584 GAGGGCGAGCAGAAGCAGGATGG - Intergenic
1057194294 9:93108202-93108224 GAGGGAGAGCCGAAGTGGGATGG + Intronic
1058102379 9:100931679-100931701 ATGGGAATGAAGAACTAGGAGGG + Intergenic
1058554987 9:106157648-106157670 GAGAGCGAGCAGAACAAGGATGG + Intergenic
1059164769 9:112067377-112067399 GTGGGATCACAGAACTGGGAAGG - Intronic
1059488569 9:114647150-114647172 TTGGGAGAGAAGAACTAAGTTGG - Intergenic
1062547143 9:137068989-137069011 GTGGGGGAGCAGTACAGGGAGGG + Intronic
1186317026 X:8382080-8382102 GTGGGGTTGCAGAACTAGGTGGG + Intergenic
1186912748 X:14186454-14186476 GGGGAAGAGTAGTACTAGGAAGG - Intergenic
1186940583 X:14502942-14502964 GTCTGAGAGCAGAAATAAGAAGG + Intergenic
1187357539 X:18591142-18591164 GTGGGAGAGAAAGACTAGGATGG - Intronic
1187378698 X:18780746-18780768 ATGGGAGAGCTGAAAGAGGAGGG + Intronic
1189173837 X:38934437-38934459 CTGGGAGAGCAGCAATAGGAAGG - Intergenic
1190056090 X:47181802-47181824 GTGGGAGAGCAGAACTAGGATGG - Exonic
1190440605 X:50471164-50471186 GTGAGAGAGCAGACACAGGATGG - Intergenic
1191764453 X:64682111-64682133 GAGGGAAAACAGAACTAGGGAGG + Intergenic
1192127855 X:68518636-68518658 GTGGGAGAGGAGAGGTAGGAAGG + Intronic
1192703246 X:73498409-73498431 GAGGGTGAGCTGAAGTAGGATGG - Intergenic
1193043882 X:77032069-77032091 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1193394396 X:80967449-80967471 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1193645627 X:84065963-84065985 GAGGGTGAGCAGAAGTAGGGTGG + Intronic
1193806547 X:86002573-86002595 GAGGGAGAGCTGAACCAGGGCGG + Intronic
1193871121 X:86799533-86799555 GAGGGAGAGCTGAAGCAGGATGG + Intronic
1194765415 X:97842661-97842683 GTGGCAGAGCAGAAGCGGGAGGG - Intergenic
1196683937 X:118495380-118495402 GCGGGAGAGGAGCACTAGGGCGG + Intergenic
1196754860 X:119149109-119149131 GTGGGAGAGGAAGACTGGGAGGG - Intronic
1197169347 X:123413866-123413888 TTGAGAGAGCAGAACTAGGAAGG + Intronic
1197184665 X:123573356-123573378 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1200365497 X:155657899-155657921 GAGGGTGAGCAGAACCAGGGTGG - Intronic
1201498739 Y:14618362-14618384 GAGGGTGAGCAGAAGTAGGATGG - Intronic
1201590552 Y:15610496-15610518 GAGGGTGAGCAGAAGCAGGATGG + Intergenic