ID: 1190057740

View in Genome Browser
Species Human (GRCh38)
Location X:47191444-47191466
Sequence TCGGGGGCCCAGATGTTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 98}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190057732_1190057740 15 Left 1190057732 X:47191406-47191428 CCCGCGCCTGGAGGCTCAGGACT 0: 1
1: 0
2: 2
3: 23
4: 235
Right 1190057740 X:47191444-47191466 TCGGGGGCCCAGATGTTTCTAGG 0: 1
1: 0
2: 0
3: 11
4: 98
1190057729_1190057740 19 Left 1190057729 X:47191402-47191424 CCTCCCCGCGCCTGGAGGCTCAG 0: 1
1: 0
2: 2
3: 35
4: 289
Right 1190057740 X:47191444-47191466 TCGGGGGCCCAGATGTTTCTAGG 0: 1
1: 0
2: 0
3: 11
4: 98
1190057733_1190057740 14 Left 1190057733 X:47191407-47191429 CCGCGCCTGGAGGCTCAGGACTG 0: 1
1: 0
2: 2
3: 58
4: 2546
Right 1190057740 X:47191444-47191466 TCGGGGGCCCAGATGTTTCTAGG 0: 1
1: 0
2: 0
3: 11
4: 98
1190057734_1190057740 9 Left 1190057734 X:47191412-47191434 CCTGGAGGCTCAGGACTGCGAGA 0: 1
1: 0
2: 1
3: 18
4: 274
Right 1190057740 X:47191444-47191466 TCGGGGGCCCAGATGTTTCTAGG 0: 1
1: 0
2: 0
3: 11
4: 98
1190057731_1190057740 16 Left 1190057731 X:47191405-47191427 CCCCGCGCCTGGAGGCTCAGGAC 0: 1
1: 0
2: 0
3: 11
4: 145
Right 1190057740 X:47191444-47191466 TCGGGGGCCCAGATGTTTCTAGG 0: 1
1: 0
2: 0
3: 11
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190057740 Original CRISPR TCGGGGGCCCAGATGTTTCT AGG Intronic
900572351 1:3364852-3364874 TCGGGGACCCTGTGGTTTCTGGG + Intronic
900937561 1:5776140-5776162 ATGGGGCCCCAGAGGTTTCTGGG - Intergenic
903162328 1:21498000-21498022 ACGTGGTCCCAGGTGTTTCTGGG - Intergenic
903345586 1:22682225-22682247 TCGGTGGCCCCGGTGTTCCTTGG + Intergenic
909719796 1:78754614-78754636 CCGTGGGCCAAGATGTATCTTGG - Intergenic
912472681 1:109916377-109916399 ATGGGGGCCCTGATGTTTTTGGG - Intronic
916141938 1:161707322-161707344 TGGGTGGCCCAGATGCTACTGGG + Exonic
919798438 1:201336071-201336093 TCTGGGGCCCAGAGTTTTCCTGG + Intergenic
920840197 1:209547510-209547532 TCTGGGGCCTAGGTATTTCTTGG - Intergenic
921561508 1:216664249-216664271 TCGGGGACCCAGTTGTTCTTTGG + Intronic
1069697378 10:70396733-70396755 AGGGGAGCCCAGATTTTTCTTGG - Intergenic
1070088880 10:73264213-73264235 TGGGGGGACCAGAGGCTTCTTGG - Intronic
1072040156 10:91599462-91599484 TGGTGGTCCCAGATGTTCCTTGG + Intergenic
1073011405 10:100362771-100362793 TCTGGGCCAGAGATGTTTCTGGG - Exonic
1076296245 10:129387128-129387150 TCAGGGTCCCCGATGTTTCCTGG - Intergenic
1077549815 11:3195177-3195199 TATGGGGCCCTGATGTTTGTGGG - Intergenic
1079128405 11:17734515-17734537 GCGCGGGCCCAGACGTCTCTCGG + Intergenic
1082794726 11:57370802-57370824 GAGGGGGCCCAGATGTGTGTGGG - Intergenic
1084752832 11:71215277-71215299 CAGGGGGACCAGATGTTACTTGG - Intronic
1084958887 11:72705910-72705932 GGGGGGGCCCAGGTGATTCTGGG - Intronic
1093761960 12:22920864-22920886 TGAATGGCCCAGATGTTTCTTGG + Intergenic
1094499128 12:31007380-31007402 TTGGGGGCCCTGGGGTTTCTGGG - Intergenic
1096111627 12:49032237-49032259 TTGGGGGCCCAGAAGGTTCTGGG + Exonic
1104156292 12:126136257-126136279 TCTGCTGCCCAGGTGTTTCTTGG + Intergenic
1110748777 13:79088395-79088417 TCAGGGTCTCAGATGTGTCTAGG + Intergenic
1112117785 13:96376045-96376067 TCGGGGTTCCATATGCTTCTGGG - Intronic
1113800592 13:113084439-113084461 TCTAGGGCACAGATGGTTCTAGG - Intronic
1120471686 14:84933623-84933645 TCGGGGGTACAGATGGTGCTTGG + Intergenic
1122066886 14:99180070-99180092 TCCCGGGACCAGATGTTTCCTGG + Intronic
1123839983 15:24238609-24238631 GTGGGGACCCAAATGTTTCTGGG + Intergenic
1124626705 15:31311906-31311928 TGGGGGCCCCAGAAGCTTCTTGG + Intergenic
1128039850 15:64562374-64562396 TTGGGGGCATAAATGTTTCTAGG - Intronic
1128742399 15:70093017-70093039 CTGGGGGCCCAGGTGTTTCAAGG - Intronic
1129061479 15:72863862-72863884 TGGGGGCCCCAGGTGTTCCTTGG - Intergenic
1135943794 16:26845991-26846013 GCTGGGGCCCTGATCTTTCTGGG + Intergenic
1138662256 16:58528497-58528519 TCGGGGAGCCTCATGTTTCTTGG + Exonic
1139675930 16:68523531-68523553 TCGGGGGCACAGAGGTATCTGGG + Intergenic
1144280669 17:13723151-13723173 TCGGGGATTCAGATGTGTCTGGG - Intergenic
1145369949 17:22299811-22299833 TGAGGGGCCTAGATGCTTCTAGG + Intergenic
1148326638 17:46786861-46786883 TGGTGGGCCCAGGTGTCTCTGGG + Intronic
1150486082 17:65544725-65544747 TGCCGGGCCCAGCTGTTTCTGGG + Intronic
1151343149 17:73484723-73484745 TGGGGGCCCCAGGTGTTCCTTGG + Intronic
1151487592 17:74411052-74411074 TGGGGGCTCCAGGTGTTTCTTGG - Intergenic
1151999230 17:77634922-77634944 TCTGGGGCCCAGGTGTTTGCTGG + Intergenic
1152498867 17:80694967-80694989 ACGGAGGCCCAGAGGCTTCTGGG - Intronic
1153749041 18:8210426-8210448 CTGGTGGCCCAGATGTTCCTTGG - Intronic
1154337484 18:13477235-13477257 TCGGGGCCCCAGCTTTTTTTAGG - Intronic
1155139136 18:23028085-23028107 TCAGGGACCCAGATGTCTCCTGG + Intergenic
1156231189 18:35155456-35155478 TTGGGAGCACAGATATTTCTTGG + Intergenic
1160979421 19:1810094-1810116 CTGGCGGCCCAGATCTTTCTGGG + Intronic
1161106188 19:2445201-2445223 TCAGGGGCCCAGAGGGGTCTGGG - Intronic
1162198538 19:9004485-9004507 TGGGGGGTGCAGATGTCTCTTGG - Intergenic
1162489978 19:10986254-10986276 TCGGGGCCCCAGATGTCTTCCGG + Exonic
1163118155 19:15200411-15200433 TTGGGGGCCCAGGTACTTCTAGG - Intronic
1165601402 19:37058087-37058109 TGAGGGGCCTAGATGCTTCTTGG + Intronic
1165601839 19:37060489-37060511 TGAGGGGCCTAGATGCTTCTTGG + Intronic
1166956447 19:46468645-46468667 TCAGGGACCCAGAAATTTCTTGG - Intronic
1167139914 19:47643339-47643361 CCGGGGCCCCAGATGTATTTGGG - Intronic
1167515849 19:49922803-49922825 TCAGGGGCCCAGGTGCTTCTGGG + Intronic
929781322 2:44959025-44959047 TCAGGAGCCCAGATGTTCCTGGG - Intergenic
936875199 2:117180712-117180734 TCTGTGGGCCAGATTTTTCTTGG + Intergenic
946143725 2:217713242-217713264 ACGGGGGCCCAGCTGATTCGAGG - Intronic
948504868 2:238421947-238421969 TGGGGGCCCCAGGTGTTCCTCGG + Intergenic
948763725 2:240208849-240208871 TCGGAGGCCCTGGTGTCTCTGGG - Intergenic
1172008618 20:31833768-31833790 TCGGGGGCACTGATGGCTCTGGG + Exonic
1175307313 20:57985244-57985266 ATGTGGCCCCAGATGTTTCTTGG + Intergenic
1177920223 21:27143343-27143365 TCAAGGGCCCAGATGTGCCTAGG - Intergenic
1179922451 21:44514445-44514467 TCGGGGGCCCAGCTGTGACGAGG + Intronic
1183303499 22:37069980-37070002 TCTGGAGCCCAGATCTGTCTGGG + Intronic
1184803168 22:46774733-46774755 TCGGGGCCCCTGATATTTCTGGG + Intronic
1184803170 22:46774740-46774762 TCGGGGGCCCAGAAATATCAGGG - Intronic
951405413 3:22290631-22290653 TGAGGGGCCTAGATGTTTCTTGG + Intronic
951618849 3:24579098-24579120 ACTGGGGCACAGATGTCTCTTGG + Intergenic
952119117 3:30220293-30220315 TGGTGGCCCCAGATGTTCCTTGG - Intergenic
952807110 3:37366204-37366226 TCTGTGGGCCAGATTTTTCTTGG - Exonic
954779276 3:53046731-53046753 TCGGCGCCCCCGATGTCTCTAGG + Intronic
955494664 3:59519166-59519188 TCGAGGGCCCAAAGTTTTCTGGG + Intergenic
961618606 3:128205267-128205289 TCAGGGACTCAGATGTATCTGGG + Intronic
962061734 3:131935086-131935108 CTGAGGGCCCAGATGTTTGTTGG + Intronic
968403482 4:318324-318346 TCAGGGTCCCAGAGCTTTCTGGG + Intergenic
968984831 4:3869434-3869456 TTGGGGCCCCAGGTGTTCCTGGG + Intergenic
973025474 4:45264156-45264178 TGGTGGGTCCAGATGTTCCTTGG - Intergenic
989115168 5:37945536-37945558 TCAGGAGCCCAGGAGTTTCTGGG + Intergenic
998149931 5:139751031-139751053 TCAGGGCCCCAAATGTTCCTGGG + Intergenic
1006636680 6:35466323-35466345 TCAGGGGCCCAAATGTTTCAAGG - Exonic
1010077960 6:71823124-71823146 TGGGGGGACCAGCTGTTCCTTGG - Intergenic
1018430648 6:163719206-163719228 TCTGGGGCCCAGATGTTCGGTGG + Intergenic
1018844768 6:167547899-167547921 TCGGAGGCACAGCTGTTTCCTGG - Intergenic
1019032426 6:169024528-169024550 TCGGATGCCCGGAGGTTTCTAGG + Intergenic
1029420090 7:100467786-100467808 GCGGGGGCCCAGATGTCCCTCGG + Intronic
1039765465 8:40623733-40623755 TCAGGGGCCCTGTGGTTTCTAGG - Intronic
1043127919 8:76423693-76423715 TCTGGGTTCCACATGTTTCTTGG - Intergenic
1043542794 8:81281363-81281385 TCGGGGGCCCTGGTGTTCCATGG - Intronic
1044877956 8:96691210-96691232 TAGTGGCTCCAGATGTTTCTTGG + Intronic
1046014135 8:108585842-108585864 AAGGGGGCCCAGCTATTTCTTGG - Intergenic
1048277149 8:133075279-133075301 TCGTGGGCCCAGAGAGTTCTGGG - Intronic
1049568395 8:143355681-143355703 TCGGGGGCCCAGATGTAACAAGG - Intronic
1051859329 9:21606614-21606636 TTGGGGGCCCATATTTTTCAAGG + Intergenic
1056796311 9:89661072-89661094 TCTGGGGGCCACATGTGTCTTGG - Intergenic
1057822185 9:98341245-98341267 TTGTGGGCACAGATGTGTCTGGG - Intronic
1057909005 9:99003924-99003946 TCGGGGGCACAGAAGTTTCCTGG + Intronic
1061404609 9:130386359-130386381 TTGGGGGCCTAGATGCTTTTGGG + Intronic
1061734595 9:132645339-132645361 TCGGGTTCCCAGTTCTTTCTCGG - Intronic
1189104143 X:38219979-38220001 AAGGGGGCCCTGGTGTTTCTTGG - Intronic
1190057740 X:47191444-47191466 TCGGGGGCCCAGATGTTTCTAGG + Intronic
1190107481 X:47570520-47570542 TCTGGGGCCTAGAGGGTTCTAGG - Intronic
1190642781 X:52496156-52496178 TCGGGGTTCCAGGTGCTTCTGGG - Intronic
1190644892 X:52516711-52516733 TCGGGGTTCCAGGTGCTTCTGGG + Intronic
1197087994 X:122501938-122501960 TCAGGGCCACAGATGTGTCTTGG - Intergenic
1199287544 X:146070554-146070576 TCTGGGCCTCAGATGTTTCTGGG + Intergenic