ID: 1190059446

View in Genome Browser
Species Human (GRCh38)
Location X:47201471-47201493
Sequence TAACCAGGACAACCCCGGTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 49}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190059440_1190059446 10 Left 1190059440 X:47201438-47201460 CCCTGGGCCTGTTTCTGAGACTC 0: 1
1: 0
2: 1
3: 30
4: 304
Right 1190059446 X:47201471-47201493 TAACCAGGACAACCCCGGTGTGG 0: 1
1: 0
2: 0
3: 0
4: 49
1190059437_1190059446 27 Left 1190059437 X:47201421-47201443 CCTGTCTGCTCTTGGTACCCTGG 0: 1
1: 0
2: 5
3: 25
4: 340
Right 1190059446 X:47201471-47201493 TAACCAGGACAACCCCGGTGTGG 0: 1
1: 0
2: 0
3: 0
4: 49
1190059442_1190059446 3 Left 1190059442 X:47201445-47201467 CCTGTTTCTGAGACTCACTCTTC 0: 1
1: 0
2: 1
3: 34
4: 276
Right 1190059446 X:47201471-47201493 TAACCAGGACAACCCCGGTGTGG 0: 1
1: 0
2: 0
3: 0
4: 49
1190059441_1190059446 9 Left 1190059441 X:47201439-47201461 CCTGGGCCTGTTTCTGAGACTCA 0: 1
1: 0
2: 0
3: 20
4: 254
Right 1190059446 X:47201471-47201493 TAACCAGGACAACCCCGGTGTGG 0: 1
1: 0
2: 0
3: 0
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190059446 Original CRISPR TAACCAGGACAACCCCGGTG TGG Exonic
902651387 1:17839899-17839921 AGACCTGGACAACCCCAGTGGGG - Intergenic
905207684 1:36352171-36352193 CAACGAGGACACCCCTGGTGAGG - Intronic
911460037 1:98177992-98178014 TAAGAAGGACAACCCCAGCGTGG - Intergenic
924749791 1:246875336-246875358 TAAGGAGGACAACACCGGGGAGG - Intronic
1063883126 10:10551329-10551351 TAACCAGGTGTACCCCGGGGAGG + Intergenic
1064220115 10:13433132-13433154 TATCCAGAATAACCCCAGTGGGG - Intergenic
1065238186 10:23676511-23676533 TAACAATGACAATCCTGGTGAGG - Intergenic
1066066915 10:31768403-31768425 GAACCAGGACAGCCCGGGTCTGG + Intergenic
1068288133 10:54965728-54965750 TAATCAGGATTACCCCAGTGAGG - Intronic
1077791130 11:5441418-5441440 AAATCAGGGCAACCCAGGTGAGG + Exonic
1093576369 12:20735270-20735292 TAACAAGGACAACTCTGATGTGG + Intronic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1103856270 12:123972979-123973001 TACCCAGGGCAACCGCAGTGCGG - Intronic
1106005860 13:25769736-25769758 TGTCCAGGACCACCCCTGTGAGG + Intronic
1115524482 14:34266288-34266310 TACCCGGGACAACCCTGCTGAGG - Intronic
1117573212 14:57069861-57069883 TAAACAGGACAAACCCTGCGAGG - Intergenic
1121576641 14:94994293-94994315 TAATCAGGTCAACCCAGGGGTGG + Intergenic
1130715160 15:86326473-86326495 TAACAAGGCCAACCAAGGTGAGG + Intronic
1140673763 16:77305790-77305812 GAAACAGGACAACCCTGGAGAGG + Intronic
1155242547 18:23877405-23877427 TAACCAGGGCCTCCCCAGTGAGG + Intronic
1158136647 18:54215178-54215200 AAACCAGGACAACCAAAGTGTGG + Intronic
1160685618 19:435182-435204 GAACCAGGACATCACCGGTCAGG + Intronic
1162940461 19:14006079-14006101 TAACCAGGGCGGCCCCGGGGTGG - Intronic
1167430101 19:49449292-49449314 GAACCAGGACTGCCCGGGTGTGG + Intronic
935691604 2:105736903-105736925 TAATCCTGACAACCCCAGTGAGG - Intergenic
942824586 2:180159836-180159858 GAAACAGGACAAACCAGGTGTGG - Intergenic
944296439 2:198068530-198068552 TGACCAGCACAACCCCTGAGAGG - Intronic
946828622 2:223705109-223705131 ACACCAGGACAACCCCCATGAGG + Intergenic
1174391534 20:50221005-50221027 TAAGCAGCACCACCCTGGTGGGG - Intergenic
953906781 3:46872388-46872410 TAAGCAGGACAGCCTCTGTGGGG + Intronic
960128001 3:114021799-114021821 TAAACAGAACAACCCAGTTGTGG - Intronic
961463931 3:127070213-127070235 TAACCAGGACAGCCTGGGGGTGG - Intergenic
976264761 4:83180072-83180094 TAACCAGGACCAGCCAGGCGCGG - Intergenic
987017730 5:13837329-13837351 AAACCAGGACAATCACGGTAGGG + Intronic
992208919 5:74458439-74458461 TAAACAGGAATACCCCAGTGTGG + Intergenic
993000346 5:82374529-82374551 TGAACAGGACAGCCCAGGTGGGG + Intronic
998681040 5:144467796-144467818 TAACCAGGACACTCCCTGCGAGG - Intronic
1001587666 5:172844514-172844536 TGACCAGGACAAGCTCGGGGTGG + Intronic
1006711026 6:36071504-36071526 TAACCAGCACCACACCTGTGAGG + Intronic
1027810394 7:82889159-82889181 TCCCCAGCACAACCCCCGTGTGG + Intronic
1029405860 7:100373726-100373748 TACCCAGGACCACCCAGATGTGG + Intronic
1035708414 8:1695129-1695151 TGACCAGGACCACCCAGCTGCGG + Intronic
1037799298 8:22023893-22023915 TGGCCAGGACAACCCAGGAGAGG - Intergenic
1041641814 8:60210716-60210738 TAAACAGGACAATCCCAGTTGGG - Intronic
1043522771 8:81064099-81064121 TCCCCAAGTCAACCCCGGTGTGG - Intronic
1049366539 8:142239677-142239699 TAATCAGGAAAACCCGAGTGGGG + Intronic
1049855704 8:144860518-144860540 TAACAAGGGTAACCCCTGTGAGG + Intergenic
1062492094 9:136810271-136810293 GCACCAGGACCACCCCTGTGTGG + Intronic
1190059446 X:47201471-47201493 TAACCAGGACAACCCCGGTGTGG + Exonic
1192873193 X:75204561-75204583 TAACAAGGGTAACCCCTGTGAGG + Intergenic