ID: 1190059848

View in Genome Browser
Species Human (GRCh38)
Location X:47203577-47203599
Sequence AACTTTGCCATGATTGGGCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190059844_1190059848 0 Left 1190059844 X:47203554-47203576 CCATTGGCTGTGAGCTGCTCAAG 0: 1
1: 1
2: 2
3: 27
4: 247
Right 1190059848 X:47203577-47203599 AACTTTGCCATGATTGGGCTGGG 0: 1
1: 0
2: 0
3: 12
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190059848 Original CRISPR AACTTTGCCATGATTGGGCT GGG Exonic
901873133 1:12150210-12150232 AATTTTGCCATTATTGTCCTTGG + Intergenic
902753434 1:18533318-18533340 GAGTTTGCCTTGAGTGGGCTTGG - Intergenic
903471450 1:23590523-23590545 AGGTTTGCCATGAGTGGGCCAGG + Intronic
903483549 1:23672474-23672496 AAAACTGCCATAATTGGGCTGGG + Intergenic
904056100 1:27671318-27671340 GACTTTGCCATGACCTGGCTAGG - Intronic
908855110 1:68418109-68418131 AACTTTGCAATGGTTAGGCCAGG + Intergenic
910159783 1:84260426-84260448 ACCTTTGCCAGGGGTGGGCTGGG + Intergenic
910534307 1:88279084-88279106 TACTTCACCATAATTGGGCTGGG - Intergenic
917123415 1:171664452-171664474 AACATTAGCATGAGTGGGCTCGG + Intergenic
917203448 1:172542651-172542673 TACTTTGCCATGGATGGGGTGGG - Intronic
919091353 1:192981840-192981862 AACTTTTCCATGAATGGGGTAGG - Intergenic
922430758 1:225550104-225550126 AAATATGCCATGATGTGGCTTGG - Intronic
924282801 1:242454967-242454989 AACTATACCCTGATTGTGCTGGG - Intronic
924744675 1:246820759-246820781 AGCTATTCCATGATTGGGTTTGG - Intergenic
1063418805 10:5894529-5894551 AATTGTGCCATGATTAAGCTGGG - Intronic
1065175992 10:23075830-23075852 AGCTTTGCCATGATGTGGATAGG + Intergenic
1066371066 10:34818501-34818523 AACTTTCCAGTGACTGGGCTAGG + Intergenic
1067223290 10:44359280-44359302 ATCTTTGGCAAGTTTGGGCTTGG - Intergenic
1067446511 10:46352057-46352079 AAGTTTGGAATGATTGAGCTGGG - Intergenic
1067590871 10:47508710-47508732 AAGTTTGGAATGATTGAGCTGGG + Intronic
1067637990 10:48016810-48016832 AAGTTTGGAATGATTGAGCTGGG + Intergenic
1070134589 10:73681233-73681255 AAGTTTGGAATGATTGAGCTGGG + Intronic
1070778788 10:79125784-79125806 ATCTGTGCCATGAGTGGGGTGGG - Intronic
1071213055 10:83366691-83366713 AAATTTGACCTGATTGGGCCTGG - Intergenic
1077150132 11:1069347-1069369 AGCTCTGCCATTCTTGGGCTGGG + Intergenic
1078112716 11:8411568-8411590 AACTTTCCCATGCTTAGGTTTGG - Intronic
1080052473 11:27871200-27871222 CACTTTGCAATGATTGCTCTGGG + Intergenic
1088701354 11:112415367-112415389 AATTTTGCCATGATGTGCCTTGG - Intergenic
1092975188 12:13737973-13737995 GACATTGCCAAGATTGGGCTCGG + Intronic
1097604413 12:61734576-61734598 AAGTTTGCCATAAATGGGATAGG - Intronic
1099563983 12:84216875-84216897 AATTTTTCCATGAATGGGTTTGG + Intergenic
1101057091 12:100928924-100928946 AACATTGCCATTATTGAGCCAGG + Intronic
1102062922 12:109947783-109947805 AAATTTGTCATGGTGGGGCTGGG + Intronic
1102911831 12:116721133-116721155 AAGTTGGCCATGAATGGGCTGGG - Intronic
1104569729 12:129914681-129914703 AGCTTTGCACTGAGTGGGCTGGG - Intergenic
1104572937 12:129941293-129941315 ACTTTTTCCATGATTGGACTTGG - Intergenic
1107311402 13:39082304-39082326 AACTTGCCCCTGGTTGGGCTGGG - Intergenic
1107332498 13:39316901-39316923 AACTATGCCATGAGAGGGCTGGG + Intergenic
1108474384 13:50799135-50799157 AGCTTTGCCTTGGTTGGGGTAGG + Intronic
1115995950 14:39196018-39196040 AAATTAGCCAGGAGTGGGCTGGG - Intergenic
1116898344 14:50338623-50338645 AACTTTACCTTGATAGGTCTAGG + Intronic
1118671702 14:68135464-68135486 AGCTTTGTCAAGATTGTGCTGGG + Intronic
1119541904 14:75444533-75444555 AACTTTCCCAAGGTTGTGCTGGG - Intronic
1119563616 14:75610140-75610162 AACTTCCCCATGACTCGGCTAGG - Intronic
1120365923 14:83569295-83569317 GACTTTACCATGTTAGGGCTTGG - Intergenic
1121628488 14:95404981-95405003 AACCATGTCATGGTTGGGCTTGG + Intergenic
1126962670 15:54015225-54015247 GACTATGCCATGATTTGGGTGGG - Exonic
1129712526 15:77827759-77827781 AACTTGACCATGCATGGGCTGGG + Intergenic
1131737549 15:95350011-95350033 CACTCTGCCATGTTTGGGGTTGG - Intergenic
1138221393 16:55254685-55254707 TACCTTGCCATCATTGGTCTGGG + Intergenic
1140925297 16:79576731-79576753 CACTCTGCCATGCTTGGCCTTGG - Intergenic
1143579106 17:7814581-7814603 TAGTTTGCCATGGTTGGGCGTGG + Intronic
1150691524 17:67371201-67371223 AACTTGGCCATTATAGGGGTTGG + Intergenic
1152047822 17:77949744-77949766 CACTGTGCCATGGTTGGTCTGGG + Intergenic
1154267579 18:12892490-12892512 AATTTTGCCTTGATTAGTCTTGG + Intronic
1156895072 18:42236695-42236717 AATTTTGCCAAGATTGGTTTAGG - Intergenic
1156969362 18:43136311-43136333 AATTTTGCCAGAAGTGGGCTAGG - Intergenic
1157197667 18:45632573-45632595 AACTTGGCTATGAAGGGGCTGGG - Intronic
1159379555 18:67638348-67638370 AGCATTGCTATGATTGGGATGGG + Intergenic
1159419584 18:68200036-68200058 ATATTTGCCATGATTGTGTTAGG + Intergenic
1161842732 19:6692799-6692821 CCCTTTGCAAAGATTGGGCTGGG - Intronic
1166918234 19:46210741-46210763 AACTTTTGCATTAGTGGGCTGGG - Intergenic
1168152158 19:54455059-54455081 AACTTTCTCAGGGTTGGGCTGGG - Exonic
930306919 2:49686257-49686279 AACTTTTCCATGGTTGAGGTGGG + Intergenic
932306233 2:70705775-70705797 AGCTTTGACATGAATGGGATGGG - Intronic
935735380 2:106102847-106102869 GACTTTGCCATACTTGGGCAAGG - Intronic
936287812 2:111194582-111194604 AGCTTTGGCAGGGTTGGGCTGGG + Intergenic
944494284 2:200290861-200290883 AAATTTGCCAAGTGTGGGCTGGG + Intergenic
946268654 2:218570155-218570177 AACATTGCCATGATGGGGAAAGG + Intronic
1171969473 20:31554790-31554812 AACTTTGCCATGCTGGGACTTGG + Exonic
1174851448 20:53999346-53999368 ATCTTTGCCAAGATTGTGCAAGG + Intronic
1175047709 20:56122900-56122922 AAAATTGCAATGATAGGGCTGGG + Intergenic
1177121820 21:17146611-17146633 AACTATAGCATTATTGGGCTTGG + Intergenic
1177949082 21:27511242-27511264 AAATTTGCCTTGATAGGTCTTGG - Intergenic
1178702619 21:34846140-34846162 AAGTTGGCCATAATGGGGCTTGG + Intronic
1179557449 21:42189119-42189141 AAATTGACAATGATTGGGCTGGG + Intergenic
1180610486 22:17093810-17093832 AACTTTGCCATGAAGGAGATGGG - Intronic
1182185939 22:28402193-28402215 AACTTTGGCATGGTAGGCCTAGG + Intronic
1182327529 22:29524975-29524997 AAGAATGCCATGATTGGGCCAGG + Intronic
1183391745 22:37549248-37549270 AGCTTTGCCATGAATGAGCTGGG - Intergenic
1185264518 22:49893354-49893376 CACTTTGCCATGATGTGCCTAGG - Intergenic
950496123 3:13335563-13335585 AACTTTGCCATGAACGTGCTCGG - Exonic
952584740 3:34877598-34877620 AACTTTTACATGATTGGCTTTGG - Intergenic
959024959 3:101230641-101230663 ACATTTGCTATGTTTGGGCTGGG - Intronic
959181498 3:102986160-102986182 AATTTTTCCATGGTTGGGTTTGG + Intergenic
962732301 3:138294752-138294774 AACTTTACCATGTTTGTGATAGG + Intronic
963709969 3:148736305-148736327 AAATTTGCCATGAGTGAGGTGGG - Intronic
963842382 3:150120801-150120823 AAAATTGTCATAATTGGGCTGGG - Intergenic
967388026 3:188929421-188929443 CCCTGTGACATGATTGGGCTTGG - Intergenic
968244876 3:197134773-197134795 AACTCTACCATTTTTGGGCTTGG + Intronic
968736169 4:2297607-2297629 ATCTTTGCCATGATCAGTCTTGG - Intronic
970498676 4:16654335-16654357 AAATTTCCCATGATTCGGATGGG - Intronic
972499215 4:39662066-39662088 AATTTTGCTGTGTTTGGGCTGGG + Intergenic
972710264 4:41588482-41588504 AATGCTGCCATGATTGGGCCTGG - Intronic
975993546 4:80286583-80286605 ATCTTTGGCTTGATAGGGCTAGG - Exonic
977233780 4:94482328-94482350 AACTTAACCAAAATTGGGCTGGG - Intronic
977566286 4:98583946-98583968 AACTTTGCCATGCTTGTCCCTGG + Intronic
978175487 4:105726804-105726826 AACTTGGCCATGGTTGGTCTTGG - Exonic
983160746 4:164411005-164411027 GCCTTTACCATGATTGGTCTTGG - Intergenic
983246666 4:165295595-165295617 AACTTTTCCAGGAATGGGATAGG + Intronic
983336433 4:166399312-166399334 AACTTTTGAATGATTGGGGTAGG - Intergenic
986430655 5:7677687-7677709 AACAATCCCATGATTGTGCTCGG - Intronic
987443838 5:17991714-17991736 ATCTTTGCCATGATTGGATTTGG + Intergenic
990177841 5:53127463-53127485 AACTTTGTCATGAGTGGCCATGG + Intergenic
992567597 5:78014469-78014491 AACTCTGCCACTAATGGGCTTGG - Intronic
993658591 5:90602518-90602540 AACTTTCTCATGATTAGACTGGG - Intronic
999693670 5:154169984-154170006 TTCTTTGCCAAGACTGGGCTGGG - Intronic
1000912336 5:167037616-167037638 AAGTTTTACATGGTTGGGCTAGG - Intergenic
1002991144 6:2239992-2240014 AGGTTTGGCATTATTGGGCTGGG - Intronic
1006527334 6:34618191-34618213 AACTCTCCCATAATTGGACTGGG + Intronic
1007235158 6:40385861-40385883 AACTTTTCCATAATTAGTCTGGG + Intergenic
1011856645 6:91701387-91701409 AAATTTGCCAGGAATGGGCTGGG + Intergenic
1012106379 6:95165209-95165231 ATATTTGCTAAGATTGGGCTGGG - Intergenic
1015606947 6:134967591-134967613 AACTCTACCATCATTGAGCTAGG + Intronic
1021415522 7:20378943-20378965 AAATTTGTGATGATTGTGCTAGG + Intronic
1021745910 7:23741220-23741242 AACTTTTCCAGGATTAGGGTAGG - Intronic
1030754433 7:113270618-113270640 AATTTTGCCATAATTTGGATGGG - Intergenic
1032387715 7:131536150-131536172 CAGTTTGCCATGATGTGGCTTGG - Intronic
1033809062 7:144989263-144989285 AACTTTGGCATGAGTGAGATGGG - Intergenic
1033944453 7:146699081-146699103 AACTTTGCAATTATTGAACTGGG - Intronic
1036228955 8:6983459-6983481 AACCTTGACATCATTAGGCTGGG + Intergenic
1036231406 8:7002564-7002586 AACCTTGACATCATTAGGCTGGG + Intronic
1036233864 8:7021660-7021682 AACCTTGACATCATTAGGCTGGG + Intergenic
1037278044 8:17202848-17202870 AAATTTGCCATGCTAGAGCTAGG - Intronic
1040569184 8:48592761-48592783 AAGCTTGCCACGCTTGGGCTAGG + Intergenic
1044784602 8:95780964-95780986 AACTTTCCCACATTTGGGCTGGG - Intergenic
1044961951 8:97539878-97539900 CAGTTTGCCAGGATTGGGCTGGG - Intergenic
1046750404 8:117920771-117920793 AACTTAGCCACAATTGTGCTGGG + Intronic
1047746361 8:127848121-127848143 AACCTTGTCATGATTAGGCTGGG + Intergenic
1048369961 8:133768666-133768688 ACCTCTGCCATCAATGGGCTCGG - Intergenic
1049326323 8:142023327-142023349 ACCTTTGCCACAGTTGGGCTGGG - Intergenic
1049559666 8:143303278-143303300 AAGTTTACCATGTTGGGGCTGGG - Intergenic
1050868596 9:10537005-10537027 AACTATCCCATAATTGGGTTGGG + Intronic
1054928669 9:70614129-70614151 AGCTTTGCCATGAACAGGCTGGG + Intronic
1057261369 9:93586680-93586702 AGGTTTGCCACGACTGGGCTTGG + Intronic
1057389182 9:94628650-94628672 CACTGTGCCCTGATTCGGCTGGG - Intronic
1058369895 9:104254068-104254090 AAAAATGCCATTATTGGGCTGGG - Intergenic
1058390029 9:104485758-104485780 AACTCAGTCATGGTTGGGCTGGG - Intergenic
1058996202 9:110300965-110300987 AACTTTGGCATCATAGAGCTGGG + Intergenic
1059557890 9:115299791-115299813 AAATTTGGCAAGATTGGGCATGG + Intronic
1185853634 X:3512055-3512077 AACTTTTCCATGGCTGGGGTTGG + Intergenic
1186111053 X:6256394-6256416 AAATTAGCCAGGCTTGGGCTGGG - Intergenic
1186394176 X:9191353-9191375 AATTTTTCCATGAATGGGGTGGG - Intergenic
1186711056 X:12197166-12197188 AACTTTGCCGAGATAGGCCTTGG + Intronic
1190010969 X:46784470-46784492 ATATTTGCCATGTTTGGCCTTGG + Intergenic
1190059848 X:47203577-47203599 AACTTTGCCATGATTGGGCTGGG + Exonic
1192440076 X:71167784-71167806 AACTTTGCCAAGACTGGGTAAGG + Exonic
1193661989 X:84268728-84268750 AAATTTGCCACAACTGGGCTGGG - Intergenic
1193769847 X:85575568-85575590 TACTTTGCAATGTGTGGGCTTGG - Intergenic
1195258178 X:103108669-103108691 AACTTTAGCATGAGTGGGCCGGG + Intergenic
1199850715 X:151723368-151723390 AACTTTGCAAAGCTGGGGCTGGG - Intergenic
1200044429 X:153393536-153393558 CACTATCCCATGATTGGTCTGGG + Intergenic
1200809811 Y:7472460-7472482 AACTTTTCCATGGCTGGGGTTGG - Intergenic
1202267441 Y:23034781-23034803 AACTTTGCCAAGATTTGGGGGGG + Intergenic
1202420433 Y:24668525-24668547 AACTTTGCCAAGATTTGGGGGGG + Intergenic
1202450353 Y:25001557-25001579 AACTTTGCCAAGATTTGGGGGGG - Intergenic