ID: 1190062835

View in Genome Browser
Species Human (GRCh38)
Location X:47222032-47222054
Sequence AAGAGGAAGCAGAAGACGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 646
Summary {0: 1, 1: 0, 2: 3, 3: 59, 4: 583}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190062828_1190062835 -4 Left 1190062828 X:47222013-47222035 CCTTGCTGGCCCAGAGCCCAAGA 0: 1
1: 1
2: 3
3: 22
4: 256
Right 1190062835 X:47222032-47222054 AAGAGGAAGCAGAAGACGGCTGG 0: 1
1: 0
2: 3
3: 59
4: 583
1190062825_1190062835 1 Left 1190062825 X:47222008-47222030 CCCCTCCTTGCTGGCCCAGAGCC 0: 1
1: 0
2: 3
3: 49
4: 408
Right 1190062835 X:47222032-47222054 AAGAGGAAGCAGAAGACGGCTGG 0: 1
1: 0
2: 3
3: 59
4: 583
1190062827_1190062835 -1 Left 1190062827 X:47222010-47222032 CCTCCTTGCTGGCCCAGAGCCCA 0: 1
1: 0
2: 3
3: 33
4: 357
Right 1190062835 X:47222032-47222054 AAGAGGAAGCAGAAGACGGCTGG 0: 1
1: 0
2: 3
3: 59
4: 583
1190062826_1190062835 0 Left 1190062826 X:47222009-47222031 CCCTCCTTGCTGGCCCAGAGCCC 0: 1
1: 0
2: 2
3: 35
4: 424
Right 1190062835 X:47222032-47222054 AAGAGGAAGCAGAAGACGGCTGG 0: 1
1: 0
2: 3
3: 59
4: 583
1190062822_1190062835 18 Left 1190062822 X:47221991-47222013 CCTGGGTCAGGTCTTTCCCCCTC 0: 1
1: 0
2: 1
3: 22
4: 304
Right 1190062835 X:47222032-47222054 AAGAGGAAGCAGAAGACGGCTGG 0: 1
1: 0
2: 3
3: 59
4: 583
1190062824_1190062835 2 Left 1190062824 X:47222007-47222029 CCCCCTCCTTGCTGGCCCAGAGC 0: 1
1: 0
2: 3
3: 43
4: 406
Right 1190062835 X:47222032-47222054 AAGAGGAAGCAGAAGACGGCTGG 0: 1
1: 0
2: 3
3: 59
4: 583
1190062821_1190062835 28 Left 1190062821 X:47221981-47222003 CCAGATGGTTCCTGGGTCAGGTC 0: 1
1: 0
2: 0
3: 8
4: 128
Right 1190062835 X:47222032-47222054 AAGAGGAAGCAGAAGACGGCTGG 0: 1
1: 0
2: 3
3: 59
4: 583

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190062835 Original CRISPR AAGAGGAAGCAGAAGACGGC TGG Intronic
900024407 1:207428-207450 ATGAAAAAGCAGAGGACGGCGGG + Intergenic
900430209 1:2597806-2597828 GACAGGAAGGAGAAGATGGCAGG - Intronic
900610482 1:3542522-3542544 AAGAGGAGGCAGAGGAAGGCAGG + Intronic
900700309 1:4044209-4044231 AAGAGGAAGAAGAAAGAGGCTGG - Intergenic
901296052 1:8161707-8161729 AGGAGGAAGGAGAAGCCGGCAGG - Intergenic
901384650 1:8899708-8899730 AAAATAAAGCAAAAGACGGCCGG - Intergenic
901520342 1:9779040-9779062 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
901647559 1:10724772-10724794 AAGAGGAGGCAGAGGAAGGCAGG + Intronic
901929282 1:12586416-12586438 GAGACGAAGCAGGAGAAGGCTGG - Intronic
902169770 1:14599947-14599969 AAGAGGAAGAAAAAGACAGTTGG + Intronic
902190193 1:14757288-14757310 AAGAGAAAGCAGGAGCAGGCAGG - Intronic
902310802 1:15580148-15580170 AAGAGGAAGAAGAAAACATCTGG + Intronic
902655776 1:17867039-17867061 CACAGGAGGCAGAAGAAGGCTGG - Intergenic
902701948 1:18178672-18178694 AAAAGGAAGGAGAAGCTGGCAGG - Intronic
902726702 1:18340959-18340981 AAGAAGAAGGAGAAGAAGGAGGG - Intronic
902960615 1:19960685-19960707 AAGGGCAAGAAGAAGGCGGCAGG - Intergenic
904306565 1:29593921-29593943 AAGAGGGAGGAGAAGGGGGCAGG + Intergenic
904496822 1:30891865-30891887 AAGAGGAAGAAGAAGAAGGGAGG + Intronic
904560682 1:31395206-31395228 AAGAAGAAGAAGAAGAAGGCGGG - Intergenic
904849779 1:33448592-33448614 AAAAAGAAGTAGAAGAAGGCAGG + Intergenic
904948157 1:34214434-34214456 AAGAGGAAGCAGGATAGGGTGGG + Intronic
905696674 1:39979757-39979779 AAGGGCAAGAAGAAGAGGGCAGG - Intergenic
906212525 1:44019988-44020010 GAGAGGAAGCTGAGGAAGGCTGG + Intronic
906479514 1:46190910-46190932 AAGAGGATGGAGAAGACGGTGGG - Intronic
906518249 1:46452244-46452266 AAGAGGAAGCAGAGTGGGGCTGG + Intergenic
906814706 1:48866983-48867005 AAGAGGAGGCAGCACAGGGCTGG + Intronic
907223960 1:52927640-52927662 AGGAGGAAGCAGAAGGCCGCAGG - Intronic
907336903 1:53705702-53705724 AACAGGAGGCAGAAGAAGGGAGG + Intronic
907443086 1:54490386-54490408 AAGAGGATGGAGAAGGCGTCTGG + Intergenic
907679695 1:56551561-56551583 AAGGGGAAGGAGAAGATGCCTGG + Intronic
907773755 1:57492196-57492218 AAGAGGCAGCTGAAGACAGCAGG + Intronic
907865897 1:58398754-58398776 GACAGGAAGCAGAGGAAGGCTGG + Intronic
908530295 1:65027578-65027600 AAGAGGGAGCTGGAGAGGGCAGG + Intergenic
910047065 1:82930860-82930882 GAGAGGAACCAGAAGTAGGCGGG - Intergenic
910437716 1:87221970-87221992 AAGAGGGAGTAGAAGAAGACAGG + Intergenic
910593552 1:88953885-88953907 AAGAAGAAGAAGAAGAAGGAGGG - Intronic
911008756 1:93255780-93255802 AAGAGGAAGAAGAAGGAGGGGGG + Intronic
911678265 1:100683941-100683963 AAGAGGAAGCTGGAGAAAGCTGG + Intergenic
913340856 1:117756978-117757000 AAGAGGATGAAGAAGAGGGATGG + Intergenic
914805908 1:150991529-150991551 AAAAAGAAGAAGAAGAAGGCCGG - Intronic
915843766 1:159240326-159240348 AGCAGGAAGCAGAAGACTACAGG - Intergenic
915970243 1:160349833-160349855 AAGGGGAAGCAGGAGAGGGAAGG - Intronic
915981882 1:160425466-160425488 AAGAGCAAGAAGAAGAAGGGTGG - Exonic
916026662 1:160838938-160838960 AAGAGGAAGGAGAAGCAGTCAGG - Exonic
916293936 1:163196247-163196269 AACAGGAACCAGAATATGGCTGG - Intronic
918724493 1:187901839-187901861 AAGAGGAAGCAGTAAATGGAGGG - Intergenic
919535548 1:198783125-198783147 GAGAGGAAGCAGCAGAAGGGGGG + Intergenic
919715205 1:200769017-200769039 AAGAGAAACCAGAACAGGGCTGG + Intronic
920107154 1:203561996-203562018 AAGAGGAAGAAGAAGAAAGAAGG + Intergenic
921361009 1:214331136-214331158 AAGAGGGAGCAGGAGAAGGATGG + Intronic
922206746 1:223454917-223454939 AAAAGGAAGGTGAAGACAGCAGG + Intergenic
922592839 1:226791519-226791541 AAGAAGAAGAAGAAGAAGGGAGG - Intergenic
922609185 1:226911800-226911822 AAGAAGAAGAAGAAGACAGCTGG - Intronic
922818249 1:228466518-228466540 AAGAAGAAGAAGAAGACATCAGG - Intergenic
923384062 1:233449213-233449235 CTGAGGAAGCCGAAGACGACAGG - Intergenic
923535645 1:234849341-234849363 AAGAGGAAGGAGCAGACGTTTGG - Intergenic
924061374 1:240178427-240178449 AAGAAGAAGAAGAAGAAGGGGGG - Intronic
924297583 1:242603994-242604016 AAGAGGTTGCAGAAGACTGTGGG + Intergenic
924383795 1:243485058-243485080 AAGAAGAAGCAGAAGAAGAGAGG + Intronic
1063057221 10:2518961-2518983 AAGAAGAAGAAGAAGAAGGGGGG + Intergenic
1065547698 10:26838408-26838430 AAGAGGAAGGAGCAGAGGACAGG + Intronic
1065967178 10:30779802-30779824 GAGAGGAAGCACAAGGAGGCAGG - Intergenic
1067150654 10:43730039-43730061 AAGAAGAAGAAGAAGAAGACAGG + Intergenic
1067288831 10:44926949-44926971 AAGAGGAAGCACCAGAAGCCAGG + Intronic
1068199974 10:53771390-53771412 AAGAGAAGGCAGAAGACAGGTGG + Intergenic
1069455390 10:68549924-68549946 AAAAAGAAGAAGAAGAAGGCTGG + Intergenic
1069819715 10:71219976-71219998 AAGAGTAAGGAGAGGTCGGCTGG - Intronic
1069987326 10:72293308-72293330 AAGAGGAAGCAGAATGGGGAGGG - Intergenic
1071040647 10:81305590-81305612 GAGATGAATCAGAAGAAGGCAGG + Intergenic
1071269750 10:83996058-83996080 AGGAGGAATGAGAAGAGGGCTGG + Intergenic
1072561522 10:96580242-96580264 AAGATGAAGCAGAAAAGGGGAGG - Intronic
1073112602 10:101071578-101071600 AAGAGGACACAGAAGAAGGAAGG - Intergenic
1073434284 10:103506855-103506877 AAAAGAAAGCAGAAGTGGGCCGG - Intronic
1073764868 10:106671020-106671042 AAGAGGACTCGGAAGATGGCTGG - Intronic
1073809464 10:107136856-107136878 AAAAGGAAGCAGGGGACGGAGGG - Intronic
1074148895 10:110740848-110740870 AAGAGGATGCAGAAGTTAGCTGG + Intronic
1074596859 10:114876067-114876089 AGGAGGAAGCAGAAGAGACCCGG + Intronic
1074959646 10:118430533-118430555 AAGAGGAAGCAACAGACGCTAGG + Intergenic
1075222974 10:120600648-120600670 CAGAGGAAGCAGAAGCAAGCCGG - Intergenic
1075330149 10:121568122-121568144 GAGAAGGAGGAGAAGACGGCAGG + Intronic
1075382800 10:122032571-122032593 AAGAGGAACCAGAAGCCCGAAGG - Intronic
1075622287 10:123936818-123936840 AAGAGGAAGATGAGGAAGGCAGG - Intronic
1075757065 10:124821268-124821290 AAGAGAAAGAAGAAATCGGCTGG + Intronic
1076485820 10:130816349-130816371 AAGAGGGTGCTGGAGACGGCAGG - Intergenic
1076897907 10:133323142-133323164 GAGAGGAAGCAGGAGAAGGATGG - Intronic
1077782590 11:5347788-5347810 AGGAGGGAGCAGAAGAGGGAGGG + Intronic
1077795715 11:5489475-5489497 GTGAGGAAGGAGAAGAAGGCAGG - Exonic
1078030501 11:7746382-7746404 AGGAGGAAGCAGACGACTGGGGG - Intergenic
1078923878 11:15857155-15857177 AAGAGACGGCAGAAGACGGATGG - Intergenic
1079310427 11:19360727-19360749 AAGGGGAGGAAGAAGAAGGCTGG + Intronic
1079424669 11:20328705-20328727 AAGAGGAAGAGGAAGAAGGAAGG - Intergenic
1080754703 11:35185614-35185636 AAGAGGAAGAAGGAGATGGATGG - Intronic
1080775109 11:35378869-35378891 AAGGGGAAGGAGAAGATGGAGGG + Intronic
1081133707 11:39411675-39411697 AAGAGGAAGAAGAAGAGGAGGGG + Intergenic
1081558716 11:44192214-44192236 AAGAAGAAGCAGGAGAGGGCTGG - Intronic
1082218758 11:49606526-49606548 AAAAGGAAGCAGAAGCTGACTGG - Intergenic
1082953168 11:58839712-58839734 AAGAGGAAGGAGAAGTCACCAGG + Intronic
1084010077 11:66342943-66342965 AAGAGGAAGCAGAAGGAGATGGG - Intronic
1084230779 11:67751117-67751139 AGGAGGAAGGAGAAGAAGGAAGG + Intergenic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084639283 11:70414823-70414845 GAGAGGAAGCAGGATGCGGCGGG + Intronic
1084892310 11:72242641-72242663 AAGAAGAAGAAGAAGAAGACTGG - Intronic
1085745632 11:79112037-79112059 AAGAGGCTGCAGAAGTCAGCTGG + Intronic
1087752289 11:102020095-102020117 AAGAAGAAGAAGAAGAGGCCAGG + Intergenic
1088381172 11:109194513-109194535 AAGAGGAGGGAGAAGAGGGAAGG - Intergenic
1089128456 11:116193720-116193742 GGGAAGCAGCAGAAGACGGCGGG - Intergenic
1089742105 11:120591566-120591588 CAGAGGAGGCAGAAGGCAGCTGG - Intronic
1089862514 11:121602604-121602626 AGGAGGAAGGAGAAGAGGGAGGG + Intronic
1090187205 11:124746357-124746379 AGGAAGTAGCAGAAGAGGGCAGG + Intronic
1090839804 11:130477947-130477969 AAGAGGAAGCAGAGGAGGCTGGG + Intergenic
1091796273 12:3299076-3299098 GAGAGGAAGAAGAAGGTGGCGGG - Intergenic
1092092246 12:5812589-5812611 AAGAGGAAGAAGAAAAAGGAAGG + Intronic
1092314814 12:7399423-7399445 AAGAGGAAGAAGAAGAATGGGGG - Intronic
1093561987 12:20552565-20552587 AAGTGGAAGCGGAAGTCGGCAGG + Intronic
1093815028 12:23535124-23535146 AAGATGAAGCAGAAGAACCCAGG + Intronic
1094008044 12:25776187-25776209 AATAGGAAGCAGAAGTCAGATGG - Intergenic
1094123607 12:26999498-26999520 AAGAGGGAGGAGAAGACAGAAGG + Intronic
1094170507 12:27486336-27486358 AAGGGGATGCAGGAGAAGGCTGG - Intronic
1094383046 12:29864560-29864582 AATAGGAGGCAGAAGACAGTTGG + Intergenic
1094727383 12:33133999-33134021 AAGGGTAAGAAGAAGAGGGCAGG + Intergenic
1095114147 12:38332005-38332027 AAGAGTAAACAAAAGAAGGCAGG - Intergenic
1095408010 12:41889666-41889688 TAGAGGAAGCAGGAGAGGGGAGG - Intergenic
1095433396 12:42159332-42159354 AAGAGAAAGCAGGAGACCCCAGG + Exonic
1096149468 12:49299564-49299586 AAGAAGAAGAAGAAGAAGCCCGG + Intergenic
1096776181 12:53965778-53965800 AAGAGGAAGAAAAAGACAGGAGG + Intergenic
1097079273 12:56417914-56417936 AACAGGAAGAAGATGAGGGCAGG - Exonic
1097790678 12:63812031-63812053 AGGAGGAAGAAGAAGAAGGAGGG + Intergenic
1098554975 12:71808107-71808129 AAGAGAGAGGAGAAGACAGCAGG - Intergenic
1098783436 12:74718348-74718370 AAGAAGAAGAAGAAGAAGACAGG - Intergenic
1099167185 12:79320988-79321010 AAGAGGGAGCACAAGCCAGCAGG - Intronic
1100877224 12:98975102-98975124 AAGAGGAAACAGAAGAAAGTAGG - Intronic
1101063025 12:100991013-100991035 AAGAAAAAGCAGAGGACAGCTGG + Intronic
1101299268 12:103461207-103461229 AAGAGTATGCAAAAGACCGCTGG + Intronic
1102959635 12:117084444-117084466 AAGAGGAGGCAGAAATCCGCTGG + Intronic
1103070209 12:117935122-117935144 AAGAAGAAGAATAAGAAGGCAGG - Intronic
1103404558 12:120666218-120666240 AAAAGGAAGAAGAAGAAGGGAGG + Intronic
1103418551 12:120761220-120761242 AGGAGGAAACAGATGATGGCTGG + Intergenic
1104085423 12:125470413-125470435 GAGAGGTAGCAGGAGAGGGCAGG - Intronic
1104316200 12:127704281-127704303 AAGAGGAAGCAGAAGAAACAAGG + Intergenic
1104703431 12:130924677-130924699 AAGAAGAAGAAGAAGAAGACTGG - Intergenic
1105565425 13:21542075-21542097 AAGAGGAAGCAGGAGAGAACGGG - Intronic
1105575809 13:21650568-21650590 AAGAGGAAGAAGGAGGGGGCTGG - Intergenic
1106176073 13:27333033-27333055 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1106184820 13:27400126-27400148 AAGTGGAAGCAAAAGATGGAAGG + Intergenic
1107510217 13:41076176-41076198 AACAGGAAGCAGAAGAAGGAGGG + Exonic
1107837223 13:44421791-44421813 AAGGGGAAGAAGAAGAGAGCAGG - Intergenic
1107859838 13:44650292-44650314 GAGAGGGAGCAAAAGAAGGCAGG - Intergenic
1107980599 13:45730908-45730930 AAGAGGCAGCAGAAGACCTTGGG + Intergenic
1107994633 13:45848172-45848194 ATGAGGAAGCAGAGGGCAGCTGG + Intronic
1111251606 13:85608633-85608655 AAGGGTAAGGAGAAGAGGGCGGG - Intergenic
1111821811 13:93224487-93224509 AAGAGGAAGCAAACGAGGCCAGG - Intergenic
1111956126 13:94760514-94760536 AAGAAGAAGAAGAAGACTTCTGG - Intergenic
1112237718 13:97651187-97651209 AAGGGCAAGAAGAAGAGGGCAGG + Intergenic
1112386563 13:98945613-98945635 AAGAGAAAGCAGAGGATGGATGG - Intronic
1112500652 13:99940567-99940589 AAGAGGACGATGAAAACGGCTGG + Intergenic
1112643170 13:101300299-101300321 AAGAGGAAGAAGAAGAAGGAGGG - Intronic
1112949679 13:104977148-104977170 AAAAGGAAGCACTAGACAGCAGG + Intergenic
1113112339 13:106837038-106837060 AAGAGGAATGAGAAGAAGGTTGG + Intergenic
1114004751 14:18300430-18300452 AGGAGGAAGCAGGAGAAGGTGGG + Intergenic
1114143196 14:19941390-19941412 AAGAGGATGCAGAAGACTCTGGG + Intergenic
1114222003 14:20705010-20705032 GAGAGGTAGCAGAAGGGGGCAGG - Intergenic
1114331474 14:21641526-21641548 AACAGGAAGGAAAAGACGGAGGG - Intergenic
1114791846 14:25668468-25668490 AAAAGGGAGCAGAAGATGGTAGG + Intergenic
1115298874 14:31861565-31861587 AAGAAGGAGGAGAAGAGGGCAGG - Intergenic
1116282414 14:42926394-42926416 AACAGGAAGCAGAAAAAAGCAGG - Intergenic
1117155443 14:52935503-52935525 AAGAAGAGACAGAAGACAGCTGG + Intronic
1117473562 14:56071015-56071037 ATGTGGAAGGAGAAGAAGGCAGG + Intergenic
1117488852 14:56226084-56226106 AAGAAGAAGAAGAAGAAGTCAGG + Intronic
1117981587 14:61347402-61347424 CAGAGAAAGCAGATGAAGGCAGG - Intronic
1118321716 14:64757362-64757384 AAGAGGAAACAGAAGAAAGGTGG - Intronic
1118516334 14:66532407-66532429 CAGAGGAAGCAGAAGATGCCAGG + Intronic
1119719694 14:76882706-76882728 CAGGGGAAGCAGAAGCAGGCAGG - Intergenic
1119749448 14:77067083-77067105 CATGGGAAGCAGAAGAGGGCTGG - Intergenic
1120479246 14:85028204-85028226 TACAGGAAGCAGAGGACAGCGGG - Intergenic
1121777024 14:96597986-96598008 AGGAGGAAGGAGAAGAGGGGAGG - Intergenic
1122409105 14:101517039-101517061 AAGGGGAAACAGAAGAAGGGAGG + Intergenic
1122531665 14:102432107-102432129 AAGAAGAAGAAGAAGAAGACAGG + Exonic
1122533570 14:102445983-102446005 AAGGGGAAGCAGAAAAGGTCGGG - Intronic
1123389211 15:19852676-19852698 AGGAGGAAGCAGGAGAAGGTGGG + Intergenic
1123394696 15:19920404-19920426 AAGACAAATCAGAAGAGGGCAGG + Intergenic
1123825767 15:24080815-24080837 AAGAGGAAGAAGAAGAAGAAAGG - Intergenic
1124969900 15:34477271-34477293 AACAGGAAGCTGAAGAAGGAAGG - Intergenic
1125311119 15:38379082-38379104 AAGAAGAAGAAGAAGAAGTCAGG - Intergenic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1125916790 15:43494818-43494840 GGGAGGAAGCAGAAGCAGGCTGG - Intronic
1125917679 15:43503749-43503771 AAGAAGAATCAGGAGAAGGCAGG - Intronic
1126432128 15:48597557-48597579 AAGAGGAAGCAGAAGTAGGAGGG - Intronic
1127318029 15:57815925-57815947 CAGAGGAAGCTGCAGAGGGCAGG + Intergenic
1127719159 15:61682968-61682990 AAGAGGAAGGAGGAGTGGGCAGG + Intergenic
1127923301 15:63512263-63512285 AAGAGGAAGAAGAAGAAGAGGGG - Intronic
1128412607 15:67414433-67414455 AAGGGGAGGCAGAGGAGGGCAGG + Intronic
1128543700 15:68553812-68553834 AAGAGGAAGGAGGCGAGGGCAGG + Intergenic
1128733469 15:70035859-70035881 AAGAGGAAGCTGAGGAGGGGTGG + Intergenic
1130095429 15:80852002-80852024 ATGAGGAAGTAGAAGACTGTGGG + Intronic
1130528667 15:84728628-84728650 TAGAAAAAGCAGAAGAGGGCCGG - Intergenic
1131284840 15:91048191-91048213 AAGAAGAAGAAGAAGAAGGAGGG - Intergenic
1131379831 15:91954608-91954630 AAGAGGAAGTGGAAGTTGGCGGG + Intronic
1132189421 15:99838478-99838500 AACAGGAAGCTGAAGAAGGAAGG + Intergenic
1132230573 15:100181037-100181059 AAGAGGAGGGAGGAGAGGGCAGG - Intronic
1132303998 15:100795564-100795586 ACCAGGAAGCAGAAGAAGACTGG + Intergenic
1132697674 16:1209195-1209217 ACGACGAAGCTGAGGACGGCAGG + Exonic
1132945660 16:2530348-2530370 AAGGGGACACAGAAGATGGCAGG - Exonic
1133015647 16:2938255-2938277 TACAGGAAGGAGAAGGCGGCTGG + Exonic
1134178730 16:12030462-12030484 AAGAGGGAGAAGGAGAAGGCTGG - Intronic
1134287185 16:12872041-12872063 AAGAGGAAGAAGAAGGAGGAGGG - Intergenic
1134432828 16:14227327-14227349 AAGAGGAAGCAAGAGAGAGCGGG - Intronic
1136539107 16:30918743-30918765 AGGAGGAAGGAGAAGAAGGAAGG - Intergenic
1137229090 16:46545281-46545303 AAGAGGAGGCAGAAGAGGCAAGG - Intergenic
1137257914 16:46792767-46792789 AAGAAAAAAAAGAAGACGGCCGG + Intergenic
1137557141 16:49477641-49477663 AAGAAGAAGGAGAAGAAGGAGGG + Intergenic
1137679215 16:50324520-50324542 AGGAAGAAGCAGAAGAGTGCAGG - Intronic
1138202131 16:55097142-55097164 AAGAGGAAGAAGAAGGAGTCTGG + Intergenic
1138430968 16:56969071-56969093 AAGAGGAGGCAGAAGAGGAGAGG - Intronic
1138676338 16:58654212-58654234 AAGAGGAAGAAGAGGAAGGTAGG - Intergenic
1138856214 16:60696708-60696730 CAGAGGAAGAAGAAGATGACTGG - Intergenic
1138933868 16:61695073-61695095 AAAAAGAAGAAGAAGAAGGCCGG - Intronic
1139010650 16:62628940-62628962 GAGAGGAAGCAAGAGACGGGAGG + Intergenic
1139356682 16:66371064-66371086 AGGAGGAAGCAGAAGGGGCCAGG + Intronic
1139558866 16:67729254-67729276 AGGAGGAAGCAGAGCAAGGCAGG + Intronic
1139681675 16:68569604-68569626 AAAAGGAATCAGAAGAGGCCAGG + Intronic
1140070992 16:71649447-71649469 AGAAGGTAGCAGAAGAAGGCTGG + Exonic
1140134670 16:72195371-72195393 GAGAGGGAGCAGAAGCGGGCAGG - Intergenic
1140296208 16:73711979-73712001 AAGGGGAAGCAAAAGAAAGCAGG + Intergenic
1140904452 16:79398487-79398509 AAGAGGAATGAGAAGATGGAGGG + Intergenic
1141031061 16:80589001-80589023 AAGAGGAAGGAGAAGAAGACTGG + Intergenic
1141053113 16:80790824-80790846 AAGATTTAGCAGAGGACGGCAGG - Intronic
1141417337 16:83886148-83886170 AGGAGGAAGCAGAAGGAGGCTGG + Intergenic
1141519289 16:84566876-84566898 AAGAGCGAGCTGAAGAAGGCGGG - Exonic
1141719267 16:85746613-85746635 AGGAGGACCCAGAAGAGGGCAGG + Intronic
1142374027 16:89697677-89697699 GAGAGGAAGGAGAAGGCGGAAGG + Exonic
1143224527 17:5289159-5289181 AAGAGGAAGAAGAAGAAGAAAGG - Intronic
1144346555 17:14354785-14354807 GAGAGGAAGCAGAAGTGGGCAGG - Intergenic
1144360242 17:14485223-14485245 AAGAAGAAGAAGAAGAAGGGGGG + Intergenic
1144653286 17:17020111-17020133 TTGAGGAAGCAGAAGAGGGTGGG - Intergenic
1144748777 17:17633904-17633926 AAGAGGGAGCAGGAGCGGGCAGG - Intergenic
1145325792 17:21823491-21823513 AAGAAGAAGCAGAAGACATTTGG - Intergenic
1147437654 17:40427403-40427425 AAGAGGATGCAGCAAACTGCTGG - Intergenic
1148406062 17:47417284-47417306 AAGAGGAGGCAGAAGAGGCAAGG + Intronic
1148432229 17:47650850-47650872 GATAGGAAGGAGAAGCCGGCCGG - Intronic
1148842152 17:50505986-50506008 GAGAGGAAGCAGGAAAGGGCTGG - Intergenic
1149303983 17:55331143-55331165 AACAGGAAGCAGAAGTGGGCAGG - Intergenic
1150702273 17:67458183-67458205 AGGAGGAAGCAGGAGGAGGCAGG - Intronic
1150801580 17:68287311-68287333 AAAAAGAAGAAGAAGAAGGCTGG - Intronic
1151467481 17:74296758-74296780 AAGAGGGAGCAGAATGAGGCTGG - Intronic
1151576851 17:74956810-74956832 GAGAGGAAGCAGAAGGAGCCAGG - Intronic
1152398316 17:80048709-80048731 ACGAGGAAGCAGAAGACGAAGGG + Exonic
1152494611 17:80662217-80662239 GATAGGAGGCAGAAGGCGGCTGG - Intronic
1153318835 18:3751857-3751879 AAGAAGAAGAAGAAGAAGTCCGG - Intronic
1153332452 18:3887810-3887832 AAAAGTAAACAGAAAACGGCCGG + Intronic
1154086540 18:11310950-11310972 AAGAGGAAGCAATAGAGAGCTGG + Intergenic
1154461227 18:14589891-14589913 AAGAGGATGCAGAAGACTCTGGG + Intergenic
1154532676 18:15363438-15363460 AGGAGGAAGCAGGAGAAGGTGGG - Intergenic
1155218314 18:23662579-23662601 GAGAGGAAGGAGGAGGCGGCGGG + Intronic
1155372818 18:25121252-25121274 AGGAAGAAGAAGAAGAAGGCTGG - Intronic
1155932804 18:31724493-31724515 GGGAGGAAGCAGAAGACCCCAGG - Intergenic
1156281966 18:35648033-35648055 AAGAAGAAGAAGAAGAAGGAAGG + Intronic
1156638234 18:39057279-39057301 AAGAAGAAGAAGAAGAAGCCAGG - Intergenic
1157394909 18:47333479-47333501 GAGAGGATGCAGAAGTGGGCAGG - Intergenic
1157434850 18:47659724-47659746 AAAAGGAAGCTGAAAAAGGCAGG - Intergenic
1157913455 18:51640953-51640975 AAGAGGAAGCAAAGGTCAGCAGG + Intergenic
1158127739 18:54120716-54120738 CAAAGGAAACAGAAGAAGGCTGG + Intergenic
1158197057 18:54899642-54899664 AAGAGGAAGAAGAAGAAGGAAGG - Intergenic
1159088732 18:63822668-63822690 AAGAGGAAGTAGAAGAAAGGAGG - Intergenic
1159399434 18:67911552-67911574 GAGAGGAAGCAAGAGAGGGCAGG - Intergenic
1159402643 18:67957457-67957479 AAGAGGAAAGAGCAGACAGCAGG - Intergenic
1159466959 18:68796118-68796140 AAGATGGAGCAGAAGAAAGCTGG + Intronic
1160149377 18:76387674-76387696 GACAGGAAGGAGAACACGGCTGG + Intronic
1160292340 18:77606463-77606485 AAGAGGAAGCTGCTGAGGGCTGG + Intergenic
1160560703 18:79754229-79754251 AGGAGGGAGCAGCAGGCGGCGGG - Exonic
1160901851 19:1432746-1432768 GGGAGGAAGCAGAAGAAGGCAGG - Intronic
1161422014 19:4181148-4181170 GAGAGGGAGGAGAAGAGGGCAGG - Intronic
1161548015 19:4894079-4894101 AAGAAGAAGAAGAAGACAGCCGG + Intronic
1161557815 19:4954467-4954489 AAGTGGAAGCGGAAGTCGGCAGG + Exonic
1161564032 19:4989635-4989657 AAGAAGAAGAAGAAGAAGACTGG - Intronic
1161625409 19:5323662-5323684 GAGAGGAAGGAGGGGACGGCAGG + Intronic
1161771392 19:6233015-6233037 AAGAGGGTGCAGAGGACGCCGGG - Intronic
1161914944 19:7221410-7221432 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
1162583065 19:11542182-11542204 AAGAAGAAGAAGAAGAAGGTCGG - Intronic
1162868410 19:13566749-13566771 GAGAGGAAGCAAGAGAGGGCAGG - Intronic
1162950036 19:14065839-14065861 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1163110670 19:15159499-15159521 AAGAGGAAGCATAAGTAGACTGG + Exonic
1163260333 19:16185768-16185790 GAGCAGAAGCAGAAGGCGGCGGG + Intronic
1163673340 19:18642222-18642244 AAGAGGAAGGAGACGTGGGCAGG - Intronic
1163703960 19:18801527-18801549 AAGAAGAAGAAGAAGAAGGGAGG - Intergenic
1163851646 19:19667788-19667810 AAAAAGAAGCAGGAGGCGGCTGG + Intergenic
1164387552 19:27788149-27788171 AAGAAGAAGAAGAAGACGAAGGG + Intergenic
1164858312 19:31542575-31542597 AAGAAGAAGAAGAAGAAGACAGG - Intergenic
1165395896 19:35563442-35563464 ATGAGCAAGAAGAAGAAGGCGGG - Exonic
1165682442 19:37789471-37789493 AAGAAGAAGAAGAAGATGGCCGG + Intronic
1166008621 19:39925123-39925145 AAGAAGAAGAAGAAGAGGGAAGG + Intronic
1166623998 19:44333631-44333653 AAGAGGAAGAGAAAGAGGGCAGG - Intronic
1166896001 19:46022292-46022314 AGGAGGAAGCTGAAGCCGGGAGG + Intronic
1166953511 19:46446332-46446354 AGGAGACAGCAGAAGAGGGCTGG + Intergenic
1167039805 19:47016944-47016966 AACAGTAAGAAGAAGATGGCTGG + Intergenic
1167385469 19:49160618-49160640 AAGAGGCTGCAGAGGAGGGCAGG + Intronic
1167665448 19:50820796-50820818 AAGAGGGAACAGAACACGGAAGG + Intronic
1168054207 19:53852568-53852590 AAGAAGAAGAAGAAGAAGGCTGG - Intergenic
1168105570 19:54163954-54163976 AAGAAGAAGAAGAAGAGGCCGGG - Intronic
925011558 2:489215-489237 AAGAGGACGCAGAGTGCGGCAGG + Intergenic
925343656 2:3154335-3154357 AAGAGGAAGCCGGTGAGGGCAGG - Intergenic
925435281 2:3831920-3831942 AAGAGGAAAGTGAAGAAGGCAGG - Intronic
926544296 2:14219978-14220000 AAGAGGAGGCATAAGATTGCTGG - Intergenic
926725054 2:15991206-15991228 AAGAAGAAGAAGAAGGTGGCCGG - Intergenic
927137603 2:20108336-20108358 AAGAAGAAAAAGAAGAGGGCCGG + Intergenic
927178988 2:20430677-20430699 AAGCGGAAGCAGATGAAGGTGGG - Intergenic
927260469 2:21083499-21083521 ATGGGGAAGCAGAAGAGTGCTGG + Intergenic
927328317 2:21832362-21832384 AAGAGGAACCAGCAGTGGGCGGG + Intergenic
928133858 2:28673445-28673467 AAGAGAAAGAAGAGGAGGGCAGG + Intergenic
928508290 2:31977104-31977126 ATAGAGAAGCAGAAGACGGCAGG + Intronic
928592896 2:32835344-32835366 GAGAGGAAGCAGAAGAGAGAGGG - Intergenic
929411319 2:41700022-41700044 ATGAGAAAGCAGAAGACAGGAGG - Intergenic
929462578 2:42114176-42114198 AAGAAGAAGAAGAAGATTGCTGG + Intergenic
929782188 2:44964388-44964410 AAGAGGAAGATGAAGAGGGTGGG - Intergenic
930477810 2:51906110-51906132 AATAGTAAGCAGAAGAGAGCAGG + Intergenic
930556787 2:52906260-52906282 AAGGGGAAGTAGAAGGAGGCTGG - Intergenic
931671718 2:64653832-64653854 AGGAGGAAGCAGGAGGCGGGCGG + Exonic
932910875 2:75805037-75805059 AAGAGGAAGCAGAAGGTTGGTGG + Intergenic
932942941 2:76190565-76190587 TAGAAGTAGAAGAAGACGGCAGG - Intergenic
933730237 2:85450721-85450743 AGGGGGAAGAAGAAGACTGCTGG + Intergenic
935099107 2:99975592-99975614 AGGAGGAAGCAGTAGGAGGCAGG + Intronic
935305733 2:101734715-101734737 AAGAAGAAGCAACAGAAGGCAGG - Intronic
935458761 2:103302639-103302661 AAGAAGAAGAAGCAGAAGGCTGG - Intergenic
935501543 2:103846852-103846874 AAGAGGAAGAGGAAGAAGGAAGG + Intergenic
935942629 2:108256953-108256975 AGGAGGAAGCAGAGGAAGACAGG + Intronic
936398580 2:112149100-112149122 TAGAGAAAGCAGAAGATGCCAGG - Intronic
936778295 2:116000518-116000540 AAGAGGAAGTAGTAGCCTGCTGG - Intergenic
937129430 2:119496568-119496590 AAGTGGAAGAAGAAGACAGATGG + Intronic
937240762 2:120460951-120460973 AAAAGGACGCAGAAGACAGGAGG - Intergenic
938176909 2:129142115-129142137 AAGATGAAGCAGACGCCAGCAGG + Intergenic
938531774 2:132194665-132194687 AGGAGGAAGCAGGAGAAGGTGGG - Intronic
938812327 2:134864855-134864877 AGGAGGAAGAAGAAGACTGATGG - Intronic
939163904 2:138619732-138619754 AATAGGAATCAGAAGACTGAAGG - Intergenic
939373847 2:141338305-141338327 AAGAGGAAGCAGAAGAAAGCAGG + Intronic
939698011 2:145352282-145352304 AAGAGGAAGAGGAATATGGCTGG + Intergenic
940126377 2:150330532-150330554 AGGAAGAAGAAGAAGAAGGCTGG + Intergenic
940180720 2:150929614-150929636 AAGCGGCAGCAGAAGGCGGGTGG + Intergenic
940724567 2:157321685-157321707 AAGAGGAAGAAGATGAGGACAGG - Exonic
941236161 2:162976940-162976962 TAGAGGAAGCAGGAGATGGGAGG - Intergenic
941367761 2:164627800-164627822 AGCAGGAAGCAGAAGACCACAGG - Intergenic
942235294 2:173898185-173898207 AAGAGGAAGAAGGAAACAGCTGG + Intergenic
942591635 2:177552808-177552830 AACCGGAAGCGGAAGACTGCCGG + Exonic
943784787 2:191865289-191865311 AGGAGGAAGTACAAGACTGCAGG - Intergenic
943913532 2:193598621-193598643 AAGAAGAAGAAGAAAACTGCAGG + Intergenic
944190160 2:196994484-196994506 AAGAAGAAGAAGAAGACTGTTGG - Intronic
944651204 2:201832000-201832022 AAGAGGAAGAGGAAGACAGGTGG - Intronic
945037910 2:205720024-205720046 AAAAGGAGGCAGAAGCTGGCTGG - Intronic
946056091 2:216903187-216903209 CAGAGGACTCAGAAGAAGGCAGG - Intergenic
946177128 2:217928757-217928779 AAGAGGAAGCAGTGGGCAGCTGG - Intronic
946668634 2:222077936-222077958 AGGAGGAAGAAGAAGACAGGGGG - Intergenic
946716639 2:222560070-222560092 ACTAGGAAGCAGGAGAGGGCAGG - Exonic
946733592 2:222732327-222732349 AAGGTGAGGCAGAAGACTGCTGG + Intergenic
946739477 2:222787817-222787839 AAGAGGACTCAGAAGTGGGCAGG + Intergenic
946974960 2:225138541-225138563 AAGAGGAAGCAGAATTGGGTAGG + Intergenic
947543344 2:230993438-230993460 AAGAAGAAGAAGAAGAAGGTGGG + Intergenic
947627718 2:231631014-231631036 AAGAAGAAGCAAAAGTTGGCCGG + Intergenic
947898268 2:233695418-233695440 AAAAAGAAGAAGAAGAAGGCCGG - Intronic
948078683 2:235187832-235187854 AAGAGGAAGAGGAAGAGGGGAGG - Intergenic
948498906 2:238376438-238376460 AAGAAGAGGCATAAGGCGGCAGG - Intronic
948720182 2:239894418-239894440 AGGTGGAAGCAGAGGACGGGAGG - Intronic
948949111 2:241237328-241237350 AACAGGACACAGAAGACAGCTGG + Intronic
1168826896 20:820007-820029 AAGAGGAAGGAGAAGGCTGAGGG - Intergenic
1168846673 20:949884-949906 AGGAGGAAGCAGGAGCCGCCAGG - Intergenic
1168955461 20:1831551-1831573 GAGAGGGAGCAGGAGAAGGCAGG + Intergenic
1169155992 20:3330236-3330258 AAGAAGAAGAAGAAGACATCTGG - Intronic
1170505841 20:17024959-17024981 CAGAGAAAGCAGAAGAAGGTGGG + Intergenic
1170532645 20:17309892-17309914 AAGAGGAAGAAGAAGAAGAAAGG + Intronic
1170823238 20:19771865-19771887 AAGAGGAGGCAGGAGGAGGCAGG - Intergenic
1172034803 20:32003156-32003178 AAAAGGAAACAGAAGAGGACAGG - Exonic
1172545147 20:35754939-35754961 AAGAAGAAGAAGAAGAAAGCAGG - Intergenic
1172792941 20:37518868-37518890 CCAAGGAAGCAGAAGACGGGAGG - Exonic
1172888583 20:38247763-38247785 AAGAGGATGCAGAAGAGGGAAGG + Intronic
1172928640 20:38564908-38564930 AAGAAGAAGAAGAAGAAGGGAGG - Intronic
1172947314 20:38699619-38699641 AAGAAGAAGAAGAAGACTTCAGG + Intergenic
1173080010 20:39856973-39856995 AAGAGGAAGAGGAAGATGGGAGG - Intergenic
1173418857 20:42882875-42882897 AAGAGGACGCACAAGACAGTAGG + Intronic
1173492314 20:43493019-43493041 CAGAGGCAGCAGAAGAGGGCAGG + Intergenic
1173549348 20:43921639-43921661 AAGAAGAAGAAGAACATGGCGGG - Intronic
1173965252 20:47107780-47107802 AAGAGGAAGAGGAAGAAGGAAGG + Intronic
1174927622 20:54777939-54777961 AAGAGGAAGTAGAAGACGATAGG + Intergenic
1174978935 20:55369882-55369904 AAGAAGAAGCAGAGGAAAGCGGG + Intergenic
1175252751 20:57619322-57619344 AAGAGGAACCTGAAGCCGGAGGG - Intronic
1175341831 20:58236857-58236879 AAAAGCATGCAGGAGACGGCTGG + Intergenic
1176214416 20:63941502-63941524 AAGAGGAAGCAGAAGTGGGCCGG + Intronic
1176385508 21:6137080-6137102 AGGAGGAGGCAGAAGTGGGCAGG - Intergenic
1176813280 21:13567957-13567979 AAGAGGATGCAGAAGACTCTGGG - Intergenic
1176893551 21:14348341-14348363 GAGAGGGAGCAGAAGAAGGCTGG + Intergenic
1178832891 21:36071128-36071150 GAGAGGAAGCAGGAGCCTGCAGG - Intronic
1178943309 21:36925566-36925588 CAGAGGAAGCAGAAGAAGGTGGG - Intronic
1179015934 21:37594603-37594625 AGAAGGAAGCAGAGGAGGGCCGG + Intergenic
1179487715 21:41721648-41721670 AAGGGAAAGCAAAAGGCGGCAGG - Intergenic
1179737965 21:43401172-43401194 AGGAGGAGGCAGAAGTGGGCAGG + Intergenic
1180429265 22:15231220-15231242 AGGAGGAAGCAGGAGAAGGTGGG + Intergenic
1181441862 22:22940841-22940863 AGGAGGAAGAAGAAGACGAAGGG + Intergenic
1181539922 22:23567554-23567576 AAGAGGAAGGAGAAGCCAGGAGG + Intergenic
1181883609 22:26001154-26001176 ATGAGGAAGAAGCAGACAGCAGG - Intronic
1182015495 22:27036048-27036070 AAGAAGAAGAAGAAGAATGCAGG - Intergenic
1182190389 22:28453990-28454012 TAAAGGAAGCATAAGAAGGCAGG - Intronic
1182367969 22:29791381-29791403 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
1182444163 22:30380521-30380543 AAGAGGAAGCTGGGGACTGCAGG - Intronic
1182711994 22:32328982-32329004 AAGAGGAAGCAGGAGGCAGAGGG - Intergenic
1183313591 22:37124925-37124947 AAGAGGAAGCAGCTGGCGGCAGG - Intergenic
1183663388 22:39234222-39234244 CAGAGGAATCAACAGACGGCTGG - Intronic
1183675686 22:39297658-39297680 AAGAGGACTCAGAAGAGGCCTGG - Intergenic
1184299808 22:43551120-43551142 AAGAGCTCGCAGAAGACGCCAGG - Intronic
1184335299 22:43849297-43849319 AAGATGGGGCAGAAGACGGCAGG + Intronic
1184399538 22:44265866-44265888 AAGAGGAAGCAGGAGGCAGAGGG - Intronic
1184509343 22:44924038-44924060 AAGAGGAGGAAGAAGAGGGAGGG + Intronic
1185396172 22:50590664-50590686 AAGAGGAAGAGGAAGAGGGAGGG - Intronic
949360914 3:3231291-3231313 AAGGTGAAGCAGAAGCTGGCAGG + Intergenic
950019433 3:9776687-9776709 AAGAGCAATAAGAAGACTGCAGG - Intronic
950613262 3:14139454-14139476 ATGAGGGAGCAGAGGAAGGCAGG + Intronic
950845804 3:16015047-16015069 AAGAGGAAGAAGACGACGGCAGG - Intergenic
951098378 3:18658014-18658036 ATCAGGAAGCAGAAGAGGGCAGG - Intergenic
951140166 3:19148620-19148642 AAGGGGAACCTGATGACGGCAGG - Exonic
951431946 3:22618394-22618416 AAGAGGAAAGAGAAGAAGGAAGG + Intergenic
951501494 3:23392512-23392534 AACAGGAAGAAGAAGAGGGAGGG + Intronic
951534678 3:23729874-23729896 AAAAGGAAGCAGGAGTGGGCAGG - Intergenic
951578480 3:24137641-24137663 ATGAGGAAGCAGAGGTAGGCAGG + Intronic
952256005 3:31696247-31696269 GAGAGGAAGCAGATGAGTGCAGG - Intronic
952685923 3:36148369-36148391 CAAAGCAAGCAGAAGACGGTGGG + Intergenic
953546090 3:43864546-43864568 AAGGGGAAGCAAAAGACTGGAGG - Intergenic
953936018 3:47043641-47043663 AAGAGGAACCTGAAGACCCCAGG + Intronic
954093897 3:48307429-48307451 AAGAGGAAGTGGAAGAAGGAAGG - Intronic
955307473 3:57848655-57848677 AAGAGGAAAAAGAAGAAGGAAGG - Intronic
955314644 3:57926320-57926342 AGGAGGAAGGGGAAGAAGGCTGG - Intronic
956586348 3:70869285-70869307 AAGAGGCAGCAGAAATTGGCAGG - Intergenic
958531280 3:95334095-95334117 AAGAGGAAGCAAAAGAGAGACGG - Intergenic
958830721 3:99085491-99085513 TAGAGGAAGCAGAAGTTTGCTGG - Intergenic
960070931 3:113429436-113429458 AACAGTAAGCATAACACGGCTGG - Intronic
960545192 3:118906273-118906295 GAGAGGAAGCTGCAGAAGGCAGG + Intronic
960680169 3:120239391-120239413 AAGAAGAAGAAGAAGAAGGGAGG - Intronic
961053097 3:123764186-123764208 AAGTAGAAACAGAAGACTGCAGG - Intronic
961616937 3:128189845-128189867 AAAAGGAAGTAGAAGGAGGCTGG - Intronic
961861652 3:129921202-129921224 CAGAACAAGGAGAAGACGGCTGG + Intergenic
961869382 3:129976783-129976805 AAGAGGAAGAGGAAGAAGGGGGG + Exonic
961879406 3:130050281-130050303 AAGAAGAAGGAGAAGAAGGAAGG + Intergenic
962982566 3:140503945-140503967 AAGGGGAGGCTGAAGATGGCAGG - Intronic
963214055 3:142724613-142724635 AAGAGGATGGAGAGGAAGGCAGG - Exonic
963349592 3:144136356-144136378 AAGTGGAATCAGAAGACAGTAGG - Intergenic
963831228 3:150011801-150011823 AAGAAGAAGAAGAAGAAGGCCGG + Intronic
964560997 3:157996520-157996542 AAGTGGAAGCAGAAGGCAGAAGG + Intergenic
964627574 3:158773842-158773864 AAGAGGAAAAGGAAGACAGCAGG - Intronic
965389561 3:168088707-168088729 GAGAGAAACCAGAAGAGGGCAGG - Intronic
965756211 3:172029912-172029934 AAGAGGAAGCAAGAGAAGGAAGG - Intergenic
966516636 3:180828248-180828270 TACAGGAAGGAGAAGGCGGCCGG - Intronic
966521891 3:180882266-180882288 AAGAGGAGGAAGAAGAAGACAGG - Intronic
966564433 3:181360760-181360782 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
966705276 3:182906790-182906812 AAGAAGAAGAAGAAGAAGGCCGG + Intronic
966956497 3:184885822-184885844 CAGAGGGAGCAGAAGAAGGAGGG - Intronic
967844990 3:194036044-194036066 ATGAGGAAGCTGATGAGGGCAGG + Intergenic
968544176 4:1188499-1188521 AATAGTAAGCAGAAGAGAGCTGG + Intronic
968981364 4:3851543-3851565 GAGAGGAAGGAGAAGATGTCTGG + Intergenic
968991632 4:3917301-3917323 AGGAGGAAGGAGAAGAAGGAAGG + Intergenic
969458048 4:7312169-7312191 AAGAGAATGAAAAAGACGGCTGG - Intronic
969885335 4:10210217-10210239 CAGAGGAAGCTGAAGACTTCTGG - Intergenic
970274658 4:14385495-14385517 AAGTGGAAGAAGAAGACAGAAGG + Intergenic
971132463 4:23827835-23827857 AAGAGGAAGAAGAAGAGGAAGGG + Intronic
971386481 4:26145011-26145033 AAAAAGAAGAAGAAGAAGGCAGG - Intergenic
971420268 4:26467987-26468009 AAGAAGAAGAAGAAGAAAGCGGG + Intergenic
975124108 4:70762487-70762509 AAGGGGAAGAAGATGAAGGCTGG - Intronic
975182024 4:71357200-71357222 AAGAGAAAGCAGCAGCCAGCTGG - Intronic
975362335 4:73485634-73485656 AAGAGGAAGAAGAAGAAGAAGGG + Intronic
975565392 4:75748733-75748755 AAGAAGAAGCAGAAAACGCCTGG + Intronic
976267185 4:83195446-83195468 AAGAGCAAGGAGAAGAGGGCGGG - Intergenic
978331545 4:107618571-107618593 AAGAGGAAACAGAAGGTGGTGGG + Intronic
978404542 4:108365107-108365129 AAGAAGAAACAGAAGAAGGCAGG + Intergenic
979405010 4:120299155-120299177 AAGAGGAAGGAGAAGAAAGGGGG - Intergenic
980185384 4:129454807-129454829 AAGAGAGAGAAGAAGATGGCAGG + Intergenic
980833034 4:138154741-138154763 AAGAAGAAGAAGAAGAAGGATGG - Intergenic
982306286 4:153934559-153934581 AAGGGGAAGGAGAGCACGGCAGG - Intergenic
982544092 4:156711108-156711130 ATGAATAAGCAGAAGACTGCAGG - Intergenic
983021847 4:162686217-162686239 AAGAAAAAGCAAAATACGGCTGG - Intergenic
983287523 4:165758775-165758797 AAAATGATGCAGAAGATGGCTGG - Intergenic
983968953 4:173847499-173847521 AAGAGAAAGCAGAAAAAGGTCGG - Intergenic
984604198 4:181765940-181765962 AGCAGGAAGCAGAAGAGGACAGG + Intergenic
985148820 4:186923863-186923885 AAGAGGAAGATGAAGAAGGGTGG + Intergenic
985747642 5:1656114-1656136 AGGAGGCAGGAGAAGGCGGCCGG + Intergenic
986731944 5:10641205-10641227 AAGAAGAAGAAGAAGAAGACTGG - Intronic
989104850 5:37852412-37852434 AGAAGGAAGCAGAAGAAGGGAGG + Intergenic
989144380 5:38234336-38234358 AGGAGGACTCAGAAGAAGGCAGG + Intergenic
989408269 5:41086725-41086747 AAGAGAAACCAGAAGGAGGCTGG - Intergenic
989424671 5:41282194-41282216 AAGAGGGAGAAAAAGAAGGCAGG - Intergenic
989784055 5:45305744-45305766 AAGAAGAAACAGAAGAAGGGAGG + Intronic
989796344 5:45478825-45478847 AAGAATAAGCTGAAGAAGGCAGG + Intronic
990379507 5:55208062-55208084 AAGAGGAAGAAGAAGAAGAAAGG + Intergenic
990494957 5:56338075-56338097 AAGAAGAAGAAGAAGACAGAAGG - Intergenic
990616713 5:57516203-57516225 AGGAGGAAGCAGGAGGCGGAAGG + Intergenic
991425770 5:66490080-66490102 TAGAAGAAGTAGAAGACGGCAGG - Intergenic
992640944 5:78767938-78767960 TAGAGGGAGCAGAAGAGGGTGGG - Intronic
992830223 5:80586800-80586822 AAGATGAATCAGAAAACTGCTGG - Intergenic
993113081 5:83683969-83683991 AAGAGGGAGAAGCAGACTGCGGG + Intronic
993315213 5:86395475-86395497 AGGAGGAAGCAGAAGAGGAAGGG + Intergenic
993741406 5:91545226-91545248 GAGAGGAAGCAGGAGAGAGCTGG + Intergenic
994169308 5:96641359-96641381 ACAAGGAACCAGAAGATGGCTGG - Intronic
994784309 5:104136577-104136599 AAGAGGAACCAGCAGAAGGTGGG + Intergenic
996167109 5:120237816-120237838 AAAAGGAAGCAGAAGAGGAGTGG - Intergenic
996540395 5:124625501-124625523 TAGAGGACGAAGAAGACGGAAGG - Intergenic
996650898 5:125874693-125874715 GTGAGGAAGCAGAATAGGGCTGG + Intergenic
997506539 5:134422019-134422041 AAGAGAAAGGAGAAGAAGGAAGG - Intergenic
997524245 5:134542153-134542175 CATAGGCAGCAGAAGACAGCAGG - Intronic
997771767 5:136561639-136561661 AAGAGGAAGGAGGAGAAGGAGGG - Intergenic
999439573 5:151591035-151591057 AGAAGGAAGCAGGAGATGGCTGG - Intergenic
999581093 5:153038962-153038984 AGGAGGAGGAAGAAGACAGCTGG + Intergenic
999907296 5:156155913-156155935 AAGAGGAAACAGAAGGTTGCAGG + Intronic
1000379281 5:160614530-160614552 AACAGGAACCAGAGGATGGCTGG - Intronic
1001532988 5:172477800-172477822 GAGAGGGAGCAGAAGGCAGCAGG - Intergenic
1001661609 5:173397342-173397364 AAGAGGGAGCTGAAGAGGGAGGG + Intergenic
1001919503 5:175588994-175589016 AAGAGGAAGGAAAGGACGGAAGG + Intergenic
1003166363 6:3682411-3682433 GAGAGGAACCAGAAGACTGGAGG - Intergenic
1003591835 6:7443246-7443268 AAAAGGAATCACAAGAGGGCAGG + Intergenic
1004184792 6:13412704-13412726 AAGAGGAGGGAGCAGAAGGCAGG - Intronic
1004943333 6:20584953-20584975 CAGAGAAAGCAGAAAACTGCAGG - Intronic
1005508417 6:26490572-26490594 AATAGGAAGCTGAAAATGGCTGG - Intergenic
1005993040 6:30915128-30915150 AAGAGAAAGCAGAAGAGGCTGGG - Intronic
1006002202 6:30973989-30974011 AAGAAGAAGAAGAAGAGGCCGGG + Intergenic
1006278674 6:33028757-33028779 AAGAGGAAGCAGTAAAAGGTGGG + Intergenic
1006751316 6:36379579-36379601 AAGAAGAAAAAGAAGAAGGCCGG + Intronic
1006846984 6:37069170-37069192 AGGAGGTAGCAGAAGACATCAGG + Intergenic
1007576678 6:42929596-42929618 GGGAAGAAGCAGAAGACAGCGGG - Exonic
1008863181 6:56176615-56176637 AAGAGGAAGGAAAAGAGGGAGGG + Intronic
1010642632 6:78348134-78348156 AAGAGAAAGAAAAAGACGGAAGG - Intergenic
1012054953 6:94394507-94394529 GAGAAGAAGCAGAAGAAGTCAGG + Intergenic
1012596003 6:101041050-101041072 AAAAAGAAGGAGAAGAAGGCAGG - Intergenic
1012713184 6:102634369-102634391 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1013424945 6:110003160-110003182 AAGAATAAGCAGAAGAAGGAAGG + Intergenic
1013485835 6:110595262-110595284 AGGAGGAAGCAAAGGATGGCTGG + Intergenic
1014683880 6:124470238-124470260 ACGAGGCAGGAGAAGACTGCAGG + Intronic
1014948005 6:127519013-127519035 AAGAGGAAAGAGAAGAAGGCGGG + Exonic
1015500068 6:133922621-133922643 ATGAGGAAACTGAAGACGGGAGG + Intergenic
1015937883 6:138420769-138420791 AAGAGGAAGCAGGACGAGGCAGG - Exonic
1016794118 6:148099645-148099667 AAGAAGAAGAAGAAGAAGCCTGG - Intergenic
1016862189 6:148731829-148731851 AAGAGGAGGCAGAAGAAGAGGGG + Intergenic
1017295159 6:152785288-152785310 AGGAGAAAGCAGAATAAGGCAGG - Intergenic
1017381928 6:153841386-153841408 TAGAAGAAACAGAAGACGGCCGG + Intergenic
1017988542 6:159466182-159466204 AAGAAGAAGAAGAAGAAGCCGGG - Intergenic
1018931594 6:168243641-168243663 GAGAGGAAGGAGAGGAAGGCTGG - Intergenic
1018931602 6:168243681-168243703 GAGAGGAAGGAGAGGAAGGCTGG - Intergenic
1019006650 6:168803391-168803413 CAGAGGGAGATGAAGACGGCAGG - Intergenic
1019313520 7:374297-374319 AAGAGGGAGAGGAACACGGCTGG - Intergenic
1019465964 7:1189138-1189160 AGGAAGAAGAAGAAGAAGGCGGG + Intergenic
1021559900 7:21959158-21959180 GAGAGGAAGCAAGAGACAGCAGG - Intergenic
1021591513 7:22268735-22268757 AAGAGGAAGCTGGAGATGACTGG - Intronic
1021626291 7:22596039-22596061 AAGAGGAAGGAGCAGCTGGCAGG + Intronic
1022001850 7:26233494-26233516 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1022500153 7:30877654-30877676 AAGAAGAAGAAGAAGAGGGAAGG - Intronic
1023479300 7:40615809-40615831 AGGATGAAGCAGAAGAAGGTGGG - Intronic
1023565693 7:41521966-41521988 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1023693433 7:42818639-42818661 AAGAGGAAGAAGGAGAAGGAAGG + Intergenic
1023909938 7:44546691-44546713 AAGAAGAAGAAGAAGCCGCCAGG + Intergenic
1023910904 7:44555789-44555811 AAGATCAGGCAGAAGAGGGCTGG + Intergenic
1024919304 7:54541706-54541728 AAGATGAAGGAAAAGAAGGCAGG + Intergenic
1025607550 7:63050288-63050310 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1026689573 7:72540244-72540266 AAGAGGAAGAAAAAGAAGGCAGG + Intergenic
1027978499 7:85187060-85187082 AAGAGGATGCTGAAAACGCCGGG + Intergenic
1028117014 7:87009661-87009683 AAAAGGAAGCAGAAGAAGACTGG + Intronic
1028369271 7:90072269-90072291 AATAGGAAGCAAAAAAAGGCAGG + Intergenic
1029554002 7:101255060-101255082 AAGAAGAAGGAGAAGCTGGCTGG + Intergenic
1030175534 7:106649690-106649712 AAGAGGAAGAAGAAGAAGGAAGG + Intergenic
1030407164 7:109129137-109129159 AAGGGCAAGAAGAAGATGGCAGG + Intergenic
1031431509 7:121676411-121676433 AAGAGGAATCAGGAGCAGGCAGG + Intergenic
1032713496 7:134483807-134483829 AAGAGGAAGGAGAAGCCTGGGGG + Intergenic
1032738494 7:134714366-134714388 CAGAGGAAGGACAAGTCGGCTGG - Intergenic
1033331467 7:140420447-140420469 AAGAAGGAGCAGAAGGAGGCAGG + Intronic
1035249170 7:157585734-157585756 AAGAGGAAGAGGAAGAGGGGAGG + Intronic
1035670649 8:1414573-1414595 GAGTGGAGGCAGAACACGGCTGG + Intergenic
1036589706 8:10157770-10157792 GAGAGAAAGAAGAAGAGGGCGGG - Intronic
1036967924 8:13320897-13320919 GAGAGGAAGCAAAAGACAGCTGG - Intronic
1037752553 8:21692364-21692386 AGGAGGAGGGAGAAGACAGCAGG + Exonic
1038709024 8:29923448-29923470 AAGAGGGAGCAGGAGAAGACTGG - Intergenic
1039546776 8:38416159-38416181 AAGAGGAGGCAGGAGATGGGAGG - Intronic
1039888395 8:41668573-41668595 CAGAAGAAGCAGCAGATGGCCGG + Intronic
1040627864 8:49172579-49172601 AAAAGGAAGCAGAAGGAAGCTGG - Intergenic
1041775493 8:61518031-61518053 AACAGGATGCAGAAGAGGACAGG - Exonic
1042268161 8:66929520-66929542 AAGAGGAAGAGGAAGAAGACAGG - Intergenic
1042561044 8:70072149-70072171 AAGAGGAAGCAGCGGCCGGGGGG - Intergenic
1042695184 8:71547740-71547762 AACTGGAGGCAGAAGCCGGCGGG + Intronic
1043548041 8:81337249-81337271 AAGAGGAGGCGGAAGAAGGAAGG + Intergenic
1043603206 8:81966405-81966427 AAGAAGAAGAAGAAGACGAAAGG - Intergenic
1044208212 8:89517315-89517337 AGGAGGAAGCAGAGGAGGGTTGG - Intergenic
1046944651 8:119963255-119963277 AAGAGGTAGGAGCAGAGGGCAGG + Intronic
1047432552 8:124805412-124805434 CAGAGGAAGCAGGAGAGGGAAGG + Intergenic
1047556687 8:125939577-125939599 GACAGGAAGCAGGAGACGGAAGG - Intergenic
1048298952 8:133237602-133237624 AAGAGGAAGCAGGAGAGGGAAGG + Exonic
1048430863 8:134369282-134369304 AAGAAGAAGAAGAAGAAGGGAGG - Intergenic
1048434534 8:134403641-134403663 AGGAGGAAACAGAAGAGGCCAGG - Intergenic
1048473375 8:134722633-134722655 ATGAGGAAGCAGAGGAGGGGAGG + Intergenic
1049371980 8:142272324-142272346 AAGAGGAAGGTGTAGACGGGCGG - Intronic
1049372026 8:142272507-142272529 AGGAGGAAGCTGTAGACGGGTGG - Intronic
1050561009 9:6834536-6834558 ACGATGAAGGGGAAGACGGCCGG - Intronic
1051546737 9:18283932-18283954 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1051705608 9:19876898-19876920 AAAATGAAGCAGAAAACAGCTGG - Intergenic
1051976686 9:22958561-22958583 AAAAGTAAGTAAAAGACGGCCGG - Intergenic
1053037827 9:34840535-34840557 AAGAAGAAGAAGAAGAAGGAAGG - Intergenic
1053299770 9:36940658-36940680 AACAGCAAGCAGGAGAAGGCAGG + Intronic
1053420733 9:37975898-37975920 AAGTGGAAGCAGGAGAGGGGTGG + Intronic
1053485724 9:38454622-38454644 AAGTGGAAGCAGAATGGGGCTGG - Intergenic
1053710384 9:40801157-40801179 AGGAGGAAGCAGGAGAAGGTGGG - Intergenic
1054420292 9:64921946-64921968 AGGAGGAAGCAGGAGAAGGTGGG - Intergenic
1055014972 9:71606401-71606423 AAGAGAATGCAGAAGACAGAAGG + Intergenic
1055264631 9:74480879-74480901 AGGAAGAAGCAGAAGACAGAGGG - Intergenic
1055452418 9:76442973-76442995 GAGAGGAAGCAGGAGATGTCAGG + Intronic
1056241751 9:84654741-84654763 AAGAGGAAACAGAAGGCAGGAGG + Intergenic
1056328037 9:85497246-85497268 AAGAGGAAGGAGAAGGAGGAAGG + Intergenic
1057129611 9:92644408-92644430 CAGAGGACGCAGATGAGGGCAGG + Intronic
1057435498 9:95036644-95036666 AGGAGGAAGAAGAGGAGGGCGGG - Intronic
1057791783 9:98129536-98129558 AAGAGGAAGCAGAGCCCAGCAGG - Intronic
1057865282 9:98675294-98675316 AGGAGGAACCAGAGGAAGGCAGG + Intronic
1058170460 9:101674349-101674371 AAGAGGAAGCAAAAGAAAGAAGG - Intronic
1059799485 9:117735881-117735903 AAAAAGAAGAAGAAGAAGGCTGG + Intergenic
1059805028 9:117789756-117789778 AAGAGGGAGCAAAAGACAGTGGG + Intergenic
1059812028 9:117865967-117865989 GGGAGGAAGCAGGAGAAGGCAGG + Intergenic
1060338598 9:122751717-122751739 GAGAGAAAGGAGAATACGGCTGG + Intergenic
1060619271 9:125048561-125048583 AAGAAGAAGAAGAAAAGGGCAGG + Intronic
1060769810 9:126324555-126324577 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1061276105 9:129570102-129570124 AAGAGGAAGGAGAAGCCAGGAGG + Intergenic
1061363620 9:130158833-130158855 AAGAGGATGCAGAAGCCCTCTGG - Intergenic
1061383282 9:130272534-130272556 AAGAAGAAGAAGAAGAGGCCAGG - Intergenic
1062145193 9:134985199-134985221 AGGAGGCAGCAGAGGAAGGCGGG - Intergenic
1185510425 X:660049-660071 AAGAAGAAGAAGAAGAAGGCTGG - Intergenic
1186320903 X:8424187-8424209 AAGAGGAAGAGGAAGACGCAGGG - Intergenic
1186829438 X:13376143-13376165 AAGAGGAAGAAAAAGACACCAGG + Intergenic
1187372039 X:18717517-18717539 AAGAGGAGGTAGGAGACAGCGGG - Intronic
1187372980 X:18725802-18725824 AAGAGGAAGTAGAAGACAGAGGG + Intronic
1187917582 X:24169803-24169825 AAGAGAAAGCAGAAGAGGAGAGG + Intronic
1188256459 X:27966988-27967010 AAGAGGAAGAAGAGGAGGGGGGG - Intergenic
1189650840 X:43187938-43187960 AAGAAGAAGTAGAAGGGGGCAGG + Intergenic
1189805108 X:44727709-44727731 AAGAAGAAGAAGAAGAAGGCCGG + Intergenic
1190062835 X:47222032-47222054 AAGAGGAAGCAGAAGACGGCTGG + Intronic
1190123416 X:47682760-47682782 AAGAGGAAGAAGAGGAAGGAAGG - Intergenic
1190814831 X:53920703-53920725 AAGAGGAAGAGGAAGAGGACAGG + Intergenic
1192130219 X:68542879-68542901 AAAAAGAAGAAGAAGAAGGCTGG - Intergenic
1192489815 X:71566163-71566185 AAGAGGAAGCAGATGAGTACAGG + Intronic
1192496056 X:71617281-71617303 AAGAGGAGGCTGTAGAGGGCTGG + Exonic
1192765741 X:74138083-74138105 AAGGGCAAGAAGAAGACGGTAGG - Intergenic
1194739324 X:97553687-97553709 AAGAAGAAGAAGAAAATGGCTGG + Intronic
1195315816 X:103676777-103676799 AAGAACAAGCAGAAGACTCCTGG - Exonic
1196581580 X:117385585-117385607 AAGAGGAAGCAGTATATGTCTGG - Intergenic
1197892880 X:131283310-131283332 AAGAGAAAACAGAAGACAACAGG - Intronic
1198169275 X:134089916-134089938 AAGGTGAAGCAGAAGCAGGCAGG + Intergenic
1198507515 X:137316274-137316296 AAGAGGATGCAAAAGATGGAGGG - Intergenic
1199702918 X:150398387-150398409 AAGAAGAAGAAGAAGAAGACAGG + Intronic
1200243837 X:154512276-154512298 AAGAAGAAGAAGAAGAAGCCGGG + Intronic
1201461675 Y:14232565-14232587 AAGAAGAAGCAGAAGAAGGAAGG - Intergenic
1201546993 Y:15176264-15176286 GAGAGGAAGCAGTAGGTGGCTGG - Intergenic
1201679584 Y:16629184-16629206 CAGAGGAACCAGAAGACAGGAGG + Intergenic
1202061703 Y:20896077-20896099 AAGGGCAAGAAGAAGATGGCAGG - Intergenic