ID: 1190063225

View in Genome Browser
Species Human (GRCh38)
Location X:47223961-47223983
Sequence CTGTCCCCCACCACGGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 280}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190063225_1190063231 9 Left 1190063225 X:47223961-47223983 CCAGGCCCCGTGGTGGGGGACAG 0: 1
1: 0
2: 1
3: 35
4: 280
Right 1190063231 X:47223993-47224015 TGCCTGTCACAGCTGCCCCAAGG 0: 1
1: 0
2: 3
3: 33
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190063225 Original CRISPR CTGTCCCCCACCACGGGGCC TGG (reversed) Intronic
900266088 1:1757944-1757966 CTGACCCCGACCACTGTGCCCGG + Intronic
900308021 1:2020257-2020279 CTTGGCCCCACCACGGGGCCTGG + Intronic
900348692 1:2224668-2224690 CTGGCCCCTACCACGGTGACAGG - Intergenic
900370372 1:2329519-2329541 CAATCCCCCACCCTGGGGCCAGG + Intronic
900406190 1:2494088-2494110 CTGTCCCCCACCAAGGGTGGGGG - Intronic
901163559 1:7198783-7198805 CTGTCCCAAACCAGAGGGCCAGG - Intronic
901923426 1:12551821-12551843 GAGTCCCCCACCACAGAGCCAGG - Intergenic
902048583 1:13544043-13544065 CTGTCCCCCAGCATGATGCCTGG - Intergenic
902717631 1:18283404-18283426 CTGTCCTCCCCAAGGGGGCCTGG - Intronic
904025946 1:27503959-27503981 CTGTCACCCCACACGGGGCTTGG - Intergenic
905441183 1:37997361-37997383 CTTTCCCATACCACGGGCCCAGG - Exonic
907323093 1:53618039-53618061 TTGTGCCCCAGCACAGGGCCTGG - Intronic
907460259 1:54601525-54601547 CTGTGCCCCAGCACGGGGGTAGG - Intronic
911219785 1:95234378-95234400 CTCCTCCCCACCACGGAGCCTGG + Intronic
912511887 1:110195330-110195352 CTCTGCCCCAGCACAGGGCCTGG - Intronic
913066839 1:115263779-115263801 CAGTCGCCCACCACCAGGCCTGG - Intergenic
915237179 1:154492499-154492521 CTGGCCCCCACCCCCAGGCCAGG + Intronic
917884065 1:179366158-179366180 GTGTCCCCCACCAGGGGTGCCGG + Intronic
917966843 1:180184181-180184203 CTGTCCCCCACCCTGGGGTCTGG + Intronic
919974332 1:202600874-202600896 GTGTCCACCACCAAGGGCCCTGG + Intronic
919988791 1:202694480-202694502 GTGTCCCTCACCACGTGGGCAGG - Intronic
920209807 1:204320048-204320070 CTTTCAGCCACCAAGGGGCCAGG + Intronic
922481155 1:225940844-225940866 CTGCCCCCGACCATGGGACCGGG + Intronic
922804245 1:228377443-228377465 GTGGCCCCCACCCCGGAGCCTGG + Intronic
924775270 1:247111653-247111675 GCGACCCCCACCACGGGCCCCGG - Exonic
1063777685 10:9283089-9283111 CAGTCCCCCACCACCATGCCTGG + Intergenic
1065307807 10:24384989-24385011 CAGCCCCCAGCCACGGGGCCTGG + Intronic
1066174301 10:32887734-32887756 CTCTCCCCCACGAGGGGGCTGGG - Intergenic
1067112821 10:43412576-43412598 CAGGCGCCCACCACGGCGCCTGG + Intergenic
1067216194 10:44306160-44306182 CCTTCCCCAACCACTGGGCCTGG + Intergenic
1068167590 10:53351718-53351740 CAGGCGCCCACCACGGCGCCCGG + Intergenic
1070587846 10:77780005-77780027 CTGGCCCCCACCCCAGGGGCAGG - Intergenic
1071053496 10:81480173-81480195 CAGGCGCCCGCCACGGGGCCCGG - Intergenic
1071509208 10:86250671-86250693 CTGTCCCCCACCTCCCGGACTGG - Intronic
1072607867 10:96999237-96999259 CTGCCCCTCACCAGGGGGCTGGG - Exonic
1072684855 10:97530149-97530171 GTGTTCCCCAGCACGGGGCCTGG + Intronic
1073225607 10:101915944-101915966 CAGGCGCCCACCACGGCGCCTGG + Intronic
1073293576 10:102425238-102425260 CTGCCCCCACCCACTGGGCCTGG + Intronic
1074539636 10:114353772-114353794 CTGTCCCCCACCCCAGGACTTGG - Intronic
1075036668 10:119075102-119075124 CAGGCACCCACCACAGGGCCCGG + Intronic
1075180261 10:120204733-120204755 CTGTCCCCCATCACAGGCCTGGG - Intergenic
1076621323 10:131790066-131790088 CTGTCACTCACCACGTGCCCAGG + Intergenic
1076779519 10:132716540-132716562 CTGTCTGCCACCAAAGGGCCGGG - Intronic
1077018374 11:406832-406854 CTGCTCCGCACCACGGAGCCGGG + Exonic
1077108930 11:853641-853663 GGGTCCCCCACCACCAGGCCAGG - Intronic
1077556530 11:3228696-3228718 CTGTCCCTCACCGAGGGGCTCGG - Exonic
1078432397 11:11298109-11298131 CTGTCCCTCACCTTGGGGCAAGG + Intronic
1078998000 11:16723665-16723687 CAGGCCCCCACCACCAGGCCGGG - Intronic
1081596578 11:44463616-44463638 CTGTACCCCACCACAGGGAGGGG - Intergenic
1083613182 11:64014093-64014115 CTGGCACCCAGCTCGGGGCCCGG + Intronic
1084231530 11:67757120-67757142 CTGTGCCCCACCTCTGGGCCTGG - Intergenic
1084478334 11:69401400-69401422 CTGATCCCAACCACAGGGCCTGG - Intergenic
1085136734 11:74097004-74097026 CAGGCACCCACCACTGGGCCTGG - Intronic
1085534281 11:77208741-77208763 CTGTGGACCACCACGGTGCCAGG + Exonic
1089330837 11:117688011-117688033 CTGTCGCCGACCACGGGGAATGG - Intronic
1090265656 11:125351411-125351433 CTGCCTCCCACCACGGGGGAGGG + Intronic
1091245378 11:134089462-134089484 CTGTACCCCACAACAGGCCCCGG + Intronic
1091589940 12:1836954-1836976 CTGCCCCCAGCCACAGGGCCTGG - Intronic
1095955660 12:47804285-47804307 ATGGCCCTCAGCACGGGGCCAGG - Intronic
1096077773 12:48815648-48815670 CTCTCCCCCTCCCCCGGGCCAGG - Intronic
1096848635 12:54421280-54421302 CTGTCCCCCACCAAGGCTCCTGG - Intergenic
1096884196 12:54700106-54700128 CTCTCTCCCACCATGGAGCCTGG - Intergenic
1097260698 12:57718459-57718481 CTGTCCTGCTCCACGGGACCAGG - Intronic
1098275290 12:68806604-68806626 CAGGCGCCCGCCACGGGGCCCGG + Intergenic
1098972242 12:76868788-76868810 CAGGCCCCCACCACCGTGCCCGG - Intronic
1101587522 12:106098006-106098028 CTGACCCCCAGCTCGTGGCCAGG - Intronic
1102573781 12:113843473-113843495 CTGTTCCCCATCACGGAGCCTGG + Intronic
1103991178 12:124800402-124800424 TTGTCCCTCATCACAGGGCCTGG - Intronic
1104746986 12:131216779-131216801 CTGCTCCCCTCCACGGGGCTGGG - Intergenic
1104785633 12:131446406-131446428 CTGCTCCCCTCCACGGGGCTGGG + Intergenic
1104803925 12:131572849-131572871 CTGTCCCCAGCCACGCGCCCAGG + Intergenic
1105898456 13:24738227-24738249 CTTTCTCCCAGCACTGGGCCTGG - Intergenic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1107522174 13:41194195-41194217 CCGCCTCCCACCACGGGGACTGG + Exonic
1107535389 13:41324516-41324538 CAGGCCCCCACCACTGGGTCTGG + Intronic
1111997098 13:95175932-95175954 CTATCCCCCACCACAGGAACAGG + Intronic
1112503028 13:99956760-99956782 CTCTCCCCCAGCCCGCGGCCCGG - Intergenic
1112656941 13:101461551-101461573 CAGTCACCCACCACTGGGTCTGG - Intronic
1113306173 13:109081488-109081510 CTGACCCCCACCACAGTGCGGGG - Intronic
1113445197 13:110360787-110360809 CCGCCCCCCACCCCGGGGCCTGG + Intronic
1115853077 14:37602735-37602757 CTCTCCCCCACCGCGGTGACTGG - Intronic
1118635968 14:67749108-67749130 CTGGCACCTAGCACGGGGCCTGG + Intronic
1118994121 14:70821865-70821887 CTGCCCCCCAACACGGGGACCGG + Intergenic
1120501899 14:85307924-85307946 CTGTCCCTGACCACGAGGACGGG + Intergenic
1121854692 14:97256456-97256478 ATGCCCCCCAGCACTGGGCCAGG - Intergenic
1122123725 14:99568158-99568180 TTGTTCCCCAATACGGGGCCTGG - Intronic
1122143171 14:99674412-99674434 CTATACCCCACCACAGAGCCTGG - Intronic
1122204598 14:100142290-100142312 CTGTTCCCCAGCCCAGGGCCAGG - Intronic
1122799240 14:104221536-104221558 ATGCCACCCACCACGTGGCCTGG - Intergenic
1122882056 14:104694672-104694694 CCGTCCCCCACCCTGGGCCCTGG + Intronic
1122883528 14:104700522-104700544 CTGTCCCCAACCACAGACCCTGG - Intronic
1126679251 15:51187864-51187886 CTGGCCCCTACCACGTGTCCGGG - Intergenic
1128037787 15:64541695-64541717 CAGGCGCCCACCACGAGGCCCGG - Intronic
1128772436 15:70292301-70292323 CTTTCCCCCTTCACTGGGCCTGG - Intergenic
1129665119 15:77575311-77575333 CTGTGCCCCACCAAGTGCCCAGG - Intergenic
1129684383 15:77676951-77676973 GTGTCCCCCACCATGGCCCCTGG + Intronic
1131178513 15:90224854-90224876 CTGTCCCCCCGCCCGGAGCCAGG - Intronic
1132320087 15:100919336-100919358 CTGCCCCCCGCGCCGGGGCCGGG - Exonic
1132341247 15:101079628-101079650 CTGTCCCCCATCACTGCCCCAGG - Intergenic
1132457136 16:30160-30182 CACTCCCCCAGCACAGGGCCTGG + Intergenic
1132594304 16:741193-741215 CTGCACCCCAACCCGGGGCCTGG - Intronic
1132691722 16:1184580-1184602 CTGCCTTCCACCAGGGGGCCTGG - Intronic
1133171345 16:3984352-3984374 CTGGCCCCCAGCACAGAGCCAGG - Intronic
1133202136 16:4210138-4210160 CTGTCCCCCACTAAGGGACCAGG - Intronic
1134048951 16:11123548-11123570 CTGTCCTCTCCCACTGGGCCTGG + Intronic
1136022404 16:27448620-27448642 CTGCCACCCACCACGGAGCCCGG + Exonic
1136428486 16:30184187-30184209 CTGTCCCCCACCTCTGGTCCGGG + Intronic
1137548298 16:49419014-49419036 CGGGCCCCCATCACGGGCCCCGG + Intergenic
1138558498 16:57786639-57786661 CTGCCCTCCACCTCGGAGCCTGG + Intronic
1139077079 16:63464541-63464563 CTGGCACCCACCACCAGGCCCGG + Intergenic
1139404411 16:66706778-66706800 CTGCCCCACCCCCCGGGGCCAGG + Intergenic
1139751781 16:69113368-69113390 CTGTCCCCCACCCCACTGCCAGG - Intronic
1142848619 17:2693850-2693872 CCATCCCCCAACACGAGGCCAGG + Intronic
1150283081 17:63940643-63940665 CTGTCCCCCATCAGGGAGCCAGG + Exonic
1151429565 17:74053210-74053232 CTGTCCCTCACCAGGGCTCCCGG - Intergenic
1151513953 17:74580239-74580261 CTGTGCCCCACCAAAGGGGCTGG - Intronic
1151619941 17:75239482-75239504 CTGCCCTTCTCCACGGGGCCCGG - Exonic
1151911894 17:77088898-77088920 CAGACCCCCTCCACGGCGCCCGG + Exonic
1152243712 17:79174115-79174137 CTGGTCCCCACCACCAGGCCTGG - Intronic
1152903288 17:82957291-82957313 CTGTCCCACAGCACAGGCCCTGG - Intronic
1153923221 18:9809541-9809563 CTGGCCACCTCCACGTGGCCTGG + Intronic
1160776027 19:856119-856141 CTGTCCCCACCCCCGGGACCCGG + Exonic
1160776687 19:859754-859776 CTGTCCCTCACCCCAGGCCCAGG - Intronic
1160799779 19:962400-962422 CTGGGCCCCACGACGGGCCCTGG + Intronic
1161017835 19:1991939-1991961 CAGGCCCCCACCACCGCGCCTGG - Intronic
1161079835 19:2305285-2305307 CTGTCCCCCACAGCAGGACCTGG + Intronic
1161323481 19:3652074-3652096 CTATCCCCCACAACGGCTCCCGG + Intronic
1161975845 19:7607506-7607528 CCTTCCCCCACCCTGGGGCCTGG + Intronic
1162053798 19:8050891-8050913 CTGTCCCAAACCACATGGCCGGG - Intronic
1162799678 19:13103596-13103618 CTGCCCCCCATGAAGGGGCCGGG - Intergenic
1163233970 19:16020475-16020497 CTGTCCCCCACCCCCGCCCCAGG - Intergenic
1165108397 19:33487583-33487605 CTGCCCCCCACCCCGGGTGCTGG - Intronic
1165952419 19:39481682-39481704 CTGTCCCGCACCAGGATGCCAGG - Intronic
1166472072 19:43087123-43087145 CTGTCTCTCACCACGTGGGCAGG - Intronic
1166485685 19:43210170-43210192 CTGTCTCTCACCACGTGGGCAGG - Intergenic
1166554640 19:43690102-43690124 GTGTCACCCTCCACGGGACCTGG + Intergenic
1166887949 19:45973133-45973155 CTGTCCCCCGCCTCGGGGAGGGG + Intronic
1166996721 19:46722999-46723021 CTGTCCCCCACCCTGGGGCAGGG - Intronic
1167156664 19:47743053-47743075 CTGTCCCCCACCCCATGGCTGGG + Exonic
1167269280 19:48498691-48498713 CTGTCCCCCGGCTTGGGGCCCGG + Exonic
1167878387 19:52433507-52433529 CAGACCCCCACCACCGCGCCTGG + Intronic
1167923732 19:52806334-52806356 CAGCCACCCACCACGGCGCCTGG + Intronic
1168315534 19:55483284-55483306 CTGGCCCCAAGCTCGGGGCCTGG - Exonic
1168707512 19:58478316-58478338 CTGTACCCCTCCACAGGACCTGG + Intronic
925190088 2:1875618-1875640 CTGTCCCCAAGCACTGGGCCAGG + Intronic
925858969 2:8156782-8156804 CTCTTCCCCACCATGGGGTCAGG + Intergenic
926200863 2:10796194-10796216 CAGTCACCCACCACCGTGCCCGG + Intronic
927177681 2:20421976-20421998 CTGTCACCCTCCACTGGGCCTGG - Intergenic
927923979 2:26996645-26996667 CAGGCGCCCACCACGGCGCCCGG - Intronic
928367828 2:30716241-30716263 CTGTCCTCCACCAGGCGGCAAGG + Intergenic
928960056 2:36915052-36915074 CTGGCGCCCACCACCAGGCCTGG - Intronic
929449267 2:42025752-42025774 CTGTCCCCCAAAACAGAGCCTGG + Intergenic
929760455 2:44802095-44802117 CTATCCCCCAGGACTGGGCCCGG - Intergenic
931583921 2:63806655-63806677 CTGACCCCCTCCCCGGGGCGTGG - Intronic
931918045 2:66980630-66980652 CAGGCTCCCACCACCGGGCCTGG + Intergenic
932495494 2:72143934-72143956 CCCTCCCCCACCTCGGGGCAAGG - Intronic
932605505 2:73163075-73163097 CTGCCCCGCCCCACGGGGTCAGG + Intergenic
933057043 2:77683394-77683416 CGGTCCCCAACCCCTGGGCCAGG - Intergenic
933698353 2:85236902-85236924 CTGTCTACCACCACGGGGCGAGG + Intronic
933897272 2:86823420-86823442 CAGGCACCCACCACGGTGCCCGG + Intronic
933927175 2:87104537-87104559 CGGTCCCCAACCCCTGGGCCAGG - Intergenic
934058870 2:88275616-88275638 CTACCCCCCACCACAGGCCCTGG + Intergenic
934715045 2:96538257-96538279 CTGTCCCTCCCCACGGAGTCTGG - Intronic
934736273 2:96691429-96691451 CTCCTCCCCACCACAGGGCCTGG + Intergenic
936452710 2:112645722-112645744 CTGTCCCGCCCCACGTGGACCGG + Intergenic
936460584 2:112711349-112711371 CTGTCCCTCTCCAAGGGTCCTGG + Intergenic
937049412 2:118876200-118876222 CTTTACCCCACCACGGGGCTAGG + Intergenic
937859646 2:126697644-126697666 ATCTCCCCCACCACGGCCCCAGG - Intergenic
937864036 2:126734710-126734732 CTGTCCCCCTCCGCTGGGACTGG - Intergenic
938537689 2:132258543-132258565 CTGGCACCCGCCACGGCGCCTGG - Intergenic
943578061 2:189653708-189653730 CTGTCCCCCACCTCTTGGACGGG - Intergenic
947135634 2:226974378-226974400 CAGGCGCCCACCACTGGGCCTGG + Intronic
947613107 2:231536063-231536085 CTGTCTCTCACCCCGGGGCAGGG - Intergenic
947740531 2:232482821-232482843 CTGACCCCCAGCTCTGGGCCAGG + Intronic
948250919 2:236528383-236528405 CTGTCCCCCACCATGATGCAGGG + Intergenic
949015864 2:241710247-241710269 CAGTCACCCACCACGAAGCCTGG + Intronic
1169214750 20:3786542-3786564 GTGCCCCCCGCCACGGGCCCGGG - Exonic
1169268178 20:4180370-4180392 CTGTCCCCCAGCCCTGGGCTAGG - Intronic
1172120962 20:32598513-32598535 CTGACACCCAGCACTGGGCCTGG + Intronic
1172689501 20:36780548-36780570 TTGTCCCCCACCCCAGGGCCAGG + Exonic
1174123201 20:48282951-48282973 CTGTCCCCCAGCAGAGGTCCAGG + Intergenic
1175932629 20:62499907-62499929 CTGTCCCGCATCAGGGAGCCAGG + Intergenic
1176124236 20:63468413-63468435 CTGAACCCCACCACTGTGCCAGG + Intronic
1178045250 21:28686375-28686397 CTGGCACCCACCACTGTGCCCGG + Intergenic
1178422447 21:32453131-32453153 CTGTGCCCCACCTCTGGGCCTGG + Intronic
1179448650 21:41452379-41452401 CGGACCCCCATCCCGGGGCCTGG - Intronic
1179641120 21:42747710-42747732 CTGGCCCCCAGCACTGTGCCAGG + Intronic
1180062082 21:45390725-45390747 CTGCCTCCCCTCACGGGGCCGGG + Intergenic
1180710852 22:17838431-17838453 GTCTCCCTCACCACAGGGCCAGG - Intronic
1180871872 22:19150841-19150863 CTGCCCGCCACCTCGGAGCCAGG + Intergenic
1181286338 22:21755068-21755090 CTGGCTCCCTCCCCGGGGCCTGG + Exonic
1181474113 22:23158127-23158149 CTCACACCCACCACGGGGTCAGG - Intronic
1182555287 22:31125706-31125728 CTGTCCCCCACCTTCCGGCCTGG + Exonic
1183778885 22:39985732-39985754 CTGACCCCAACCAAGAGGCCTGG - Intergenic
1184109344 22:42385731-42385753 CTGTCCAGCACCCCAGGGCCTGG + Intronic
1185203336 22:49521970-49521992 CTCTCCCCTCCCACGCGGCCAGG + Intronic
1185410002 22:50676867-50676889 CTGACCCCAACCATGGGGCCAGG - Intergenic
950118809 3:10468271-10468293 CTGTGCCCCACTAAGGGCCCTGG - Intronic
950151737 3:10692790-10692812 CTGTCCCCCACCACATGTCCTGG - Intronic
950488878 3:13290136-13290158 CTGTCCCCCACCCCCTAGCCTGG + Intergenic
950523886 3:13512447-13512469 CTGGCACCCAACACAGGGCCTGG - Intergenic
952970883 3:38649546-38649568 CAGCCGCCCACCCCGGGGCCCGG - Exonic
953534254 3:43765323-43765345 CTGTCCCACCCCATGGGGCAGGG + Intergenic
954300694 3:49699381-49699403 CCACCCCCCACCCCGGGGCCTGG - Intronic
954964931 3:54602058-54602080 CAGTCCTCCACCACAGTGCCTGG + Intronic
954990142 3:54833519-54833541 CTGTCCCCCAACACGTTGCTAGG - Intronic
957048072 3:75391969-75391991 CTGTGCCCCACCTCTGGGCCTGG - Intergenic
957203885 3:77169839-77169861 CCGTTCCCCACCAAGGGGGCAGG + Intronic
957855375 3:85869802-85869824 GTGCCCGCCACCACGGGGCCTGG + Intronic
960521256 3:118658161-118658183 CTGTCCACTGCCTCGGGGCCTGG + Intergenic
960906992 3:122611479-122611501 CAGGTGCCCACCACGGGGCCTGG + Intronic
961826505 3:129601906-129601928 CTGGCACCCACCACAGAGCCTGG + Intronic
966034519 3:175395197-175395219 CTGTCCCCCACCATCCTGCCTGG - Intronic
966482166 3:180422871-180422893 CAGTCGCCCACCACCGCGCCCGG - Intergenic
968916819 4:3500256-3500278 CTGTCCACAGCCACGGGTCCTGG - Intronic
968992531 4:3924426-3924448 CTGTGCCCCACCTCTGGGCCTGG - Intergenic
969174598 4:5388920-5388942 CTGTGCCACTCCATGGGGCCTGG - Intronic
969822823 4:9733196-9733218 CTGTGCCCCACCTCTGGGCCTGG + Intergenic
972823695 4:42731929-42731951 CTGTACCCCAGCCTGGGGCCTGG + Intergenic
979804663 4:124956227-124956249 CAGTCCCACACCACCAGGCCAGG - Intergenic
980504907 4:133705846-133705868 CAGTCCCCCACCACAATGCCCGG - Intergenic
980750189 4:137077478-137077500 CTGTCCCCCACCAAGAGCACAGG + Intergenic
983354872 4:166644094-166644116 CTGTCCCTGGCCACTGGGCCAGG + Intergenic
984716617 4:182931585-182931607 CAGGCGCCCACCACAGGGCCTGG + Intergenic
985621681 5:959393-959415 CACTCCCCCACCATGGGGCTGGG + Intergenic
985647688 5:1092853-1092875 ATCTCCCCCAACACGGGTCCAGG + Intronic
985657642 5:1140386-1140408 CTGTTCCCCCCCACCGGGTCTGG + Intergenic
985824382 5:2181762-2181784 GTGTCCACCACCCCAGGGCCTGG + Intergenic
985854716 5:2415956-2415978 CTGCCCCCGCCGACGGGGCCTGG - Intergenic
986164714 5:5263788-5263810 CTGCCCCCCACTACAGGGTCAGG - Intronic
986297220 5:6449313-6449335 CTGGCCCTCACCACGGGGCCCGG - Intronic
986443159 5:7798720-7798742 CAGGCCCCCACCACCGTGCCTGG + Intronic
987817844 5:22927310-22927332 CAGTCACCCACCACCAGGCCTGG + Intergenic
988554001 5:32221013-32221035 CAATCCCCCACCCAGGGGCCAGG - Intergenic
997593780 5:135092602-135092624 CTGTCCCAGCCCACAGGGCCTGG - Intronic
998401654 5:141851703-141851725 CTGGCCCCAACCAGGGGGCTGGG + Intergenic
999158020 5:149472377-149472399 GTGTGCCCCACCACGCCGCCTGG + Intergenic
1000426902 5:161101894-161101916 CAGGCCCCCACCACCGCGCCTGG + Intergenic
1000722889 5:164730406-164730428 CTTTCTCACGCCACGGGGCCTGG - Intergenic
1001816450 5:174673230-174673252 CTGCCCCCCTCCCCGCGGCCAGG + Intergenic
1002187731 5:177462343-177462365 CTGCTCCCCACCCGGGGGCCAGG + Intronic
1002325185 5:178399952-178399974 CTGTGCCCCAGCACAGTGCCAGG - Intronic
1002440111 5:179259837-179259859 GTGTCCTCAACCTCGGGGCCTGG + Intronic
1004021757 6:11782351-11782373 CTGTTCCCCACCATGAGACCAGG + Intronic
1004143601 6:13044641-13044663 CTGGCCCCCACCAGGTGGCAAGG - Intronic
1006154988 6:32009099-32009121 CTGTCTCCTACCGAGGGGCCTGG - Intergenic
1006161299 6:32041834-32041856 CTGTCTCCTACCGAGGGGCCTGG - Exonic
1007290370 6:40781226-40781248 CTGTCCCCCTCCATGGGGGCTGG + Intergenic
1007413492 6:41678684-41678706 TTGTCCCCACCCACGGGCCCAGG - Intergenic
1007414426 6:41683617-41683639 ATGCCCCCCACCCCGGGCCCAGG + Intergenic
1017508608 6:155092038-155092060 CAGGCCCACACCACTGGGCCCGG + Intronic
1018620023 6:165721182-165721204 CTGTGCCACACCCCGTGGCCTGG - Intronic
1018967698 6:168501473-168501495 CCCTCCCTCGCCACGGGGCCAGG + Intronic
1018967708 6:168501508-168501530 CTGTCCCTCGCTATGGGGCCAGG + Intronic
1019433445 7:1010252-1010274 CTGTCCCCAAGCACTGGGTCTGG + Intronic
1019599664 7:1874937-1874959 GTGGCCCCCACCCCGGGCCCCGG + Intronic
1019605626 7:1908839-1908861 ATGACCCCCACCACACGGCCTGG + Intronic
1019737240 7:2656625-2656647 CTGTCCCTCACCTCTGGGACTGG - Intronic
1020098455 7:5381215-5381237 CTGTCCCCCACCCCTGCGCTTGG + Intronic
1020211263 7:6159650-6159672 CTGTCCCCAAGCGCGTGGCCTGG - Intronic
1020254023 7:6491777-6491799 CAGTCCCCCACCACCACGCCTGG + Intergenic
1020274711 7:6617027-6617049 CTGTCCCCCGCAACGGGGAACGG - Intronic
1020315182 7:6900782-6900804 CTGTGCCCCACCTCTGGGCCTGG - Intergenic
1023582966 7:41701263-41701285 CTCTGCCCCACCACGTGGCCAGG - Intronic
1023842093 7:44103770-44103792 CTGGGGCCCAGCACGGGGCCCGG + Intergenic
1023966198 7:44964200-44964222 CTGTCACCCACCAGGGCCCCAGG + Intronic
1024996703 7:55278067-55278089 CTGACACCCACCACGTGGCCAGG - Intergenic
1029323108 7:99782614-99782636 GTGACCTCCACTACGGGGCCAGG + Intronic
1029900156 7:104030746-104030768 CAGTCGCCCACCACTGCGCCCGG + Intergenic
1032018155 7:128392688-128392710 CTGGCCCCCACCCCAGGGGCAGG - Exonic
1033097308 7:138442520-138442542 CTGGCCCCCACCCCAGGGGCAGG + Intergenic
1033269921 7:139921558-139921580 CAGGCACACACCACGGGGCCTGG - Intronic
1033303494 7:140207485-140207507 ATGTCCCTGACCACGGGGCCTGG - Intergenic
1034225156 7:149475797-149475819 CTGTGCCCCACCACAGTGCAGGG + Intronic
1034276677 7:149826829-149826851 CTGCTCCCCACCCCAGGGCCAGG - Intergenic
1034283263 7:149868142-149868164 TTCACCCCCACCACGGGGTCAGG - Intergenic
1036122782 8:6036292-6036314 CTGTCCCTGACCACTGGGCAGGG + Intergenic
1036938040 8:13024184-13024206 CTGGCACCCACCACGACGCCCGG + Exonic
1037245440 8:16829640-16829662 CAGTCGCCCACCACCGCGCCTGG + Intergenic
1038547230 8:28435015-28435037 CTGCCCCACACGACAGGGCCAGG - Intronic
1039474870 8:37834319-37834341 CAGTTCCCCACCACGGAGTCTGG - Intronic
1041693752 8:60714594-60714616 CTGCCCCCCACTTCGCGGCCTGG + Intronic
1043516059 8:80996189-80996211 CTGCCCACGACCACGGGGACTGG - Intronic
1045315353 8:101039263-101039285 CTGTCTCCCATCAGGAGGCCTGG - Intergenic
1047275564 8:123402397-123402419 CTGGCCCCCACCCCAGGGGCAGG + Intronic
1047619989 8:126596482-126596504 CAGGCGCCCACCACGGCGCCCGG + Intergenic
1049310677 8:141932076-141932098 CTGTCCCCCACCATGGCTCCCGG + Intergenic
1049398769 8:142415428-142415450 CTGTCCCCCACCACTGCCACTGG - Intergenic
1049555823 8:143281481-143281503 CTGTCCCCACCCTCGGGGCCAGG - Intergenic
1050684765 9:8155569-8155591 CAGCCCCCCAGCACAGGGCCTGG + Intergenic
1051196205 9:14565149-14565171 CTGCCTCCCACCACTGGGGCTGG - Intergenic
1051265588 9:15306464-15306486 CCCTCTCCCTCCACGGGGCCGGG - Intronic
1053249714 9:36564368-36564390 CTGGTGCCCACCACGAGGCCTGG + Intergenic
1055029407 9:71758403-71758425 CTGTACCCCACCAGGGGGTTGGG - Intronic
1059340296 9:113594193-113594215 CTGTCCCCCACCCCGCGTCCTGG - Intronic
1059459952 9:114423393-114423415 GTGTCCCCAGCCCCGGGGCCTGG + Exonic
1061330662 9:129890340-129890362 TTGTCCCCCACGAGGTGGCCCGG + Exonic
1061373233 9:130209616-130209638 CTCTTCCCCAACACGGCGCCAGG - Intronic
1061471185 9:130827128-130827150 CTGACCCCCAGCATGGGTCCGGG + Intronic
1061838338 9:133343498-133343520 CTGGGACCCAGCACGGGGCCTGG + Intronic
1062386612 9:136314374-136314396 CTTCCCCCCACCACGGGGGCAGG + Intergenic
1062513916 9:136922708-136922730 CCGTCCTCCACCACGTGCCCAGG - Intronic
1062527565 9:136984486-136984508 CTGGCACCCGCCATGGGGCCTGG - Exonic
1062533827 9:137013001-137013023 CTGCCGCCCACCGCTGGGCCAGG - Exonic
1186982194 X:14969145-14969167 CTCTCCCCCACGACAGGCCCTGG + Intergenic
1187238736 X:17493518-17493540 CAGTCCCCCAGCACAGTGCCTGG + Intronic
1187908534 X:24089364-24089386 CAGGCCCCCACCACCGTGCCTGG + Intergenic
1189291717 X:39890765-39890787 CTGACCCCCACCACAGGCCCAGG + Intergenic
1190063225 X:47223961-47223983 CTGTCCCCCACCACGGGGCCTGG - Intronic
1190080698 X:47354772-47354794 CTGTCCTTCTCCACAGGGCCAGG - Intergenic
1190157150 X:48003592-48003614 CAGGCCCCCACCTCGGGGCTTGG + Exonic
1192320018 X:70083264-70083286 CTGTCACCAGCCACAGGGCCAGG + Intergenic
1195937926 X:110143010-110143032 CTCTCCCCAACCAAGGAGCCGGG - Intronic
1198077446 X:133207325-133207347 CAGTCCCCCAGCACATGGCCTGG - Intergenic
1198529419 X:137536049-137536071 CAGGCACCCACCACGGCGCCTGG + Intergenic
1199996789 X:153030869-153030891 CTGTCCCCCACCCCTTGTCCTGG + Intergenic
1200399223 X:156009566-156009588 CACTCCCCCAGCACAGGGCCTGG - Intronic