ID: 1190063266

View in Genome Browser
Species Human (GRCh38)
Location X:47224114-47224136
Sequence GCTCAGAGCCGGCAGCTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 154}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190063266_1190063270 -4 Left 1190063266 X:47224114-47224136 CCACCTAGCTGCCGGCTCTGAGC 0: 1
1: 0
2: 0
3: 15
4: 154
Right 1190063270 X:47224133-47224155 GAGCTCAGCTTGCCCTTGGAAGG 0: 1
1: 1
2: 4
3: 25
4: 259
1190063266_1190063269 -8 Left 1190063266 X:47224114-47224136 CCACCTAGCTGCCGGCTCTGAGC 0: 1
1: 0
2: 0
3: 15
4: 154
Right 1190063269 X:47224129-47224151 CTCTGAGCTCAGCTTGCCCTTGG 0: 1
1: 1
2: 6
3: 47
4: 462
1190063266_1190063271 0 Left 1190063266 X:47224114-47224136 CCACCTAGCTGCCGGCTCTGAGC 0: 1
1: 0
2: 0
3: 15
4: 154
Right 1190063271 X:47224137-47224159 TCAGCTTGCCCTTGGAAGGAAGG 0: 1
1: 0
2: 2
3: 17
4: 212
1190063266_1190063275 11 Left 1190063266 X:47224114-47224136 CCACCTAGCTGCCGGCTCTGAGC 0: 1
1: 0
2: 0
3: 15
4: 154
Right 1190063275 X:47224148-47224170 TTGGAAGGAAGGGTTCCACTAGG 0: 1
1: 0
2: 0
3: 16
4: 185
1190063266_1190063272 1 Left 1190063266 X:47224114-47224136 CCACCTAGCTGCCGGCTCTGAGC 0: 1
1: 0
2: 0
3: 15
4: 154
Right 1190063272 X:47224138-47224160 CAGCTTGCCCTTGGAAGGAAGGG 0: 1
1: 0
2: 3
3: 34
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190063266 Original CRISPR GCTCAGAGCCGGCAGCTAGG TGG (reversed) Intronic
901232683 1:7649979-7650001 GCTCAGAGGCGGCTGCTCTGTGG + Intronic
901530575 1:9849998-9850020 GCCCAGAGCCGGCAGCAGAGGGG + Exonic
901829382 1:11882924-11882946 GCTGACAGCCAGGAGCTAGGCGG - Intergenic
902531209 1:17091907-17091929 AGGCAGAGCCGGCAGCTACGAGG + Intronic
903163251 1:21504008-21504030 GCTCAGAGCTGACTGCTAGGAGG + Intergenic
910838097 1:91535693-91535715 GCGCCGCGCCGGCAGCTAGGGGG + Intergenic
912264061 1:108137683-108137705 GATCAGAGCTGGCAGACAGGAGG + Intronic
914754297 1:150554101-150554123 GCTAAGAGCCTGCAGCCAAGCGG + Exonic
915519968 1:156436333-156436355 GCTGGGAGGCGGCGGCTAGGAGG - Intergenic
915724522 1:158008140-158008162 GCTCCTAGCCGGCAGCGAGGGGG + Intronic
916713875 1:167434288-167434310 GCAAAGAGCTGGCAGCTCGGAGG - Intronic
923079597 1:230641204-230641226 GATAAGAGCCGGAAGCTAGCTGG - Intergenic
923369473 1:233295744-233295766 GCTCAGAGGCGGCTGCTCAGAGG + Intergenic
923766506 1:236896938-236896960 GCACAGGGCCTGCAGCTAGCAGG - Intronic
1063720925 10:8580636-8580658 GCACAGAGCCGGGAGACAGGAGG - Intergenic
1064157581 10:12916490-12916512 GCTCAAAGCCTGAAGCTATGTGG + Intronic
1067703673 10:48591135-48591157 GCTCAGAGCCTCCAGAGAGGAGG + Intronic
1069792238 10:71030105-71030127 GTTCAGAGACGGCAGCTCAGAGG - Intergenic
1070669346 10:78367173-78367195 GCTCAGAGCTGACAGCCAAGGGG - Intergenic
1073099439 10:100999252-100999274 TCTCCGAGCCGGCCGCCAGGTGG + Intronic
1073345730 10:102781556-102781578 GCACAGAGCAGGCAGGGAGGAGG - Intronic
1076599368 10:131647020-131647042 GCTGAGAGCCGGCCCCTAGCAGG + Intergenic
1076600092 10:131651829-131651851 GCTGAGAGCTGGCAGCAGGGCGG + Intergenic
1076669643 10:132112382-132112404 GCCCAGAGAGGGCAGCGAGGAGG + Intronic
1078578805 11:12523340-12523362 GCTCAGGGCTGGCAGCTGGTGGG - Intronic
1080029566 11:27646612-27646634 GCTCAGAGCAGGTTGCTTGGAGG + Intergenic
1083297550 11:61723208-61723230 GCTCAGAGCAGGCAGCTCTGTGG - Intronic
1084007001 11:66328399-66328421 GCTCCCAGCCTGCTGCTAGGAGG - Intergenic
1084322188 11:68379509-68379531 GCTCAGAGCTGCCAGTGAGGTGG - Intronic
1084426590 11:69087359-69087381 GCTCAGAGCCGGGATCGGGGCGG + Intronic
1084890289 11:72233396-72233418 GGTTAGAGCTGACAGCTAGGAGG - Intronic
1085640340 11:78189119-78189141 GGCCAGAGCCGGCTGCTGGGCGG - Exonic
1086242437 11:84711654-84711676 GCTCAAAGCAGGCAGGCAGGAGG + Intronic
1089294813 11:117461200-117461222 GGTCAGAGCCAGGAGCAAGGTGG - Intronic
1089301609 11:117502280-117502302 CCACAGAGCCGGCAGCTCAGCGG + Intronic
1091288927 11:134426112-134426134 GCTTTGAGCCGGCAACAAGGAGG - Intergenic
1091301285 11:134509757-134509779 GCTCACAGGAGACAGCTAGGAGG - Intergenic
1091641286 12:2239504-2239526 GCTGAGACCCAGCAGCTGGGTGG - Intronic
1096516205 12:52156959-52156981 GCTCAGAGCCTGCAGATGGTGGG + Intergenic
1100018531 12:90041923-90041945 GGTCAGAGACAGCAGCTAGTGGG - Intergenic
1101303481 12:103504453-103504475 GCTCAGTGCAGGCAGCCTGGAGG + Intergenic
1101836276 12:108297827-108297849 GCTCAGAGAAGGCAGCTCTGTGG - Intronic
1103409016 12:120697477-120697499 TCTCTGAGCCAGCAGCCAGGAGG + Exonic
1107014364 13:35696572-35696594 GGTGAGAGCCCGCAGCAAGGTGG - Intergenic
1107767968 13:43757517-43757539 GCTCAGAGCCGGCTGGTTGAGGG - Intronic
1113553886 13:111215814-111215836 GCTCAGAGGCAGCAGCTGTGCGG - Intronic
1114516475 14:23302823-23302845 GCTCAGAGCAGACCGCTAGCAGG - Exonic
1114553933 14:23550920-23550942 GCTCAGAGCTGTCAGCCTGGAGG - Intronic
1117467161 14:56005156-56005178 TCTGTGAGCCGGCGGCTAGGAGG - Intergenic
1118723428 14:68609825-68609847 ACTCTGAGGAGGCAGCTAGGGGG - Intronic
1119114261 14:72003944-72003966 GCTAAGAGCCAGCAGCTGAGGGG + Intronic
1119179820 14:72598199-72598221 GCTCAACTCCGGCAGCCAGGAGG - Intergenic
1121629036 14:95409211-95409233 CCTCAGAGCAGCCAGCTAGGCGG - Intronic
1123991507 15:25687060-25687082 GCTCAGACCCAGCAGGAAGGGGG - Intronic
1124686452 15:31786774-31786796 GCTCTGAGAAGGCAGCTATGTGG + Intronic
1125417255 15:39466699-39466721 GCTCTGAGGCGGCAGCTGGAAGG + Intergenic
1129124231 15:73424072-73424094 GCTTAGAACCGGGAGCTTGGGGG + Intergenic
1129706664 15:77798356-77798378 GCTCAGGGCCGCCAGCCAGGTGG - Intronic
1130096761 15:80861956-80861978 CCTCAGAGCCGGCAGCTAAAAGG - Intronic
1137675341 16:50301223-50301245 GCTCAGAGGCCGCAGCTGGGGGG + Intronic
1138561022 16:57801258-57801280 GCTCAGAGACTGCAGCAAGCAGG + Intronic
1139383126 16:66547242-66547264 GCACAGAGCCCGCAGCTGAGTGG - Intronic
1141249706 16:82344200-82344222 GTTCAGAGCCTGGTGCTAGGTGG + Intergenic
1141431041 16:83970299-83970321 GCCCAGAGCCGGCACCTACCTGG + Intronic
1141529306 16:84635208-84635230 GCTCAGAGCCGCTAGCTGTGCGG - Intergenic
1141769400 16:86080250-86080272 GTTCAGAGCCTGCAGATACGGGG + Intergenic
1142518019 17:445903-445925 GCGCACAGCCGGGAGCCAGGGGG + Exonic
1142744058 17:1946357-1946379 GCTCAGTCCCTGCAGCCAGGAGG + Intronic
1142852065 17:2709103-2709125 GCTCAAAGGCGGCAGAGAGGAGG + Intronic
1144644461 17:16962788-16962810 GAGCAGAGCCGGCAGCCAGCAGG + Intronic
1144715865 17:17435569-17435591 GCTCAGCTCCTGCAGCCAGGGGG - Intergenic
1147042669 17:37730542-37730564 GCTCGGAGCCATCAGCTGGGTGG - Intronic
1149996282 17:61407627-61407649 CTTCAGAGCCTGCAGATAGGAGG + Intronic
1150051215 17:61965093-61965115 GTTCAGAGTGGTCAGCTAGGAGG - Exonic
1150489393 17:65563886-65563908 GCTCAGAGCTGGTGGCTAAGAGG - Intronic
1151575249 17:74949860-74949882 GCTCAGAGCTCCGAGCTAGGAGG + Exonic
1151670762 17:75570544-75570566 GCTCAGAGCAGCCAGCAGGGGGG + Intronic
1151834710 17:76574991-76575013 GAACTGAGCTGGCAGCTAGGGGG + Intronic
1152191816 17:78892755-78892777 GCTCCGGGCCTGCAGCTGGGTGG + Intronic
1152614551 17:81331734-81331756 GCCCAGGGCCTGCAGCTGGGAGG - Intergenic
1153270275 18:3313885-3313907 GCTCAAAGCAGTCAGGTAGGAGG + Intergenic
1155046930 18:22110799-22110821 ACTCAGGGCCTGCAGCGAGGTGG - Intergenic
1160227125 18:77020026-77020048 GGGCAGAGCAGGCAGCTATGTGG + Intronic
1161235084 19:3193647-3193669 GCACAGAGCCAGCAGCTGGGAGG - Intronic
1161312113 19:3600494-3600516 GCTCAGGGCCAGCAGGTTGGAGG + Exonic
1162088339 19:8261883-8261905 GCTCAGAGCAGGGAGGAAGGAGG - Intronic
1163558878 19:18007624-18007646 GCCCAGAGCCACCAGCTAAGCGG + Intronic
1164430673 19:28185809-28185831 ACTAAGAGCCTGCAGCTTGGAGG + Intergenic
1167645418 19:50702861-50702883 GGGCAGAGCCGGAAGCCAGGAGG - Intronic
926101858 2:10122975-10122997 GCTCAGGGCCGGCGGCTGCGGGG - Exonic
926707365 2:15846222-15846244 GCTCAGAGCTGGCCTCCAGGAGG + Intergenic
928182595 2:29080084-29080106 GCACAGAGCCGGCACCTGTGCGG - Intergenic
936517036 2:113187416-113187438 GCTGAGAACAGGAAGCTAGGTGG + Intronic
936517523 2:113191907-113191929 GCTGAGAACAGGAAGCTAGGTGG - Intronic
941008476 2:160270865-160270887 TCTCAGAGCTTTCAGCTAGGTGG + Intronic
943510467 2:188819938-188819960 GCTCAAAGCAGGCAGGAAGGAGG + Intergenic
945088673 2:206159175-206159197 CCTGAGAGCCGGCAGATGGGGGG - Exonic
947426238 2:229985495-229985517 GATCAGAGAGGGCAGCAAGGAGG - Intronic
948708638 2:239811375-239811397 GCTCAGAGCCTTCAGCTAAGCGG + Intergenic
948863534 2:240764191-240764213 GCTGAGAGCAGCCAGCAAGGAGG - Intronic
1169062762 20:2673498-2673520 GCTCACAGGGTGCAGCTAGGAGG - Intergenic
1174987741 20:55474398-55474420 AATCAGAGCCTGCAACTAGGTGG - Intergenic
1175894298 20:62329286-62329308 GCCCAGAGCCTGCAGCGGGGAGG + Intronic
1175975895 20:62710329-62710351 GGTCAGGGCAGGCAGCTGGGAGG - Intronic
1177494662 21:21873234-21873256 GCTCAGAGCCAGCAGATGTGAGG - Intergenic
1178043436 21:28667776-28667798 ACTCAGATCCCACAGCTAGGAGG - Intergenic
1178156530 21:29860248-29860270 GCTCACAAGCTGCAGCTAGGAGG - Intronic
1178379517 21:32096225-32096247 GCTCAGAGGAAGCAGCTCGGGGG - Intergenic
1181035027 22:20165700-20165722 GCTCAGTGGGGGCAGCTAGAGGG + Intergenic
1182444567 22:30382606-30382628 CCTCAGAGCAGCCAGCTGGGTGG + Intronic
1184562431 22:45270924-45270946 GCTCAGAGCAGTCAGGTAGTAGG - Intergenic
1184841276 22:47053589-47053611 CCTCAGAGACGCCAGCGAGGAGG + Intronic
953404744 3:42654728-42654750 GGTCAGAGCTGGCAGGTGGGCGG - Intronic
954615767 3:51967940-51967962 GAGCAGAGCCGGGAGCTAGGCGG - Intronic
955677291 3:61462337-61462359 GCACAGAGCCTACACCTAGGAGG - Intergenic
959127277 3:102305773-102305795 GCTTAGAGCCATCAGATAGGAGG + Intronic
961168909 3:124781893-124781915 GCCCACAGCCAGCAGGTAGGTGG - Intronic
966832064 3:184018079-184018101 GAACAGAGCCGGGAGCTCGGTGG - Intergenic
969217053 4:5731110-5731132 GGTCAGAGTTGGCAGCTGGGAGG + Intronic
969398947 4:6940801-6940823 TCTCCGAGCTGGCAGCCAGGAGG + Intronic
975139119 4:70902400-70902422 GCCGAGAGCCGGCTGCTCGGTGG - Exonic
976830413 4:89308129-89308151 GCGCCGGGCCGGGAGCTAGGAGG + Intergenic
979277043 4:118825800-118825822 GTGCACAGCAGGCAGCTAGGTGG - Intronic
981081846 4:140644479-140644501 TCGCAGGGCCGGCAGCCAGGCGG + Intronic
985016379 4:185639244-185639266 GCTCAGAGCAGGCAGCCGGGAGG - Intronic
985451648 4:190066442-190066464 GCTCCGTGCTGGCAGCTGGGCGG - Intergenic
985453621 4:190073030-190073052 GCTCCGTGCTGGCAGCTGGGCGG - Intergenic
985454611 4:190076323-190076345 GCTCCGTGCTGGCAGCTGGGCGG - Intergenic
985455599 4:190079616-190079638 GCTCCGTGCTGGCAGCTGGGCGG - Intergenic
985456583 4:190082910-190082932 GCTCCGTGCTGGCAGCTGGGCGG - Intergenic
985457571 4:190086210-190086232 GCTCCGTGCTGGCAGCTGGGCGG - Intergenic
985458558 4:190089503-190089525 GCTCCGTGCTGGCAGCTGGGCGG - Intergenic
985459547 4:190092803-190092825 GCTCCGTGCTGGCAGCTGGGCGG - Intergenic
985463798 4:190175572-190175594 GCTCCGTGCTGGCAGCTGGGAGG - Intronic
985525793 5:401055-401077 GCTCAGAGCGGGCAGTTGGATGG + Intronic
986764795 5:10915663-10915685 GCTCAAAGCAAGCAGCTAGGAGG + Intergenic
999315434 5:150580375-150580397 GCTCAGAGCTGTCAGGAAGGTGG - Intergenic
1001971373 5:175957464-175957486 GCCCAGAGCAGGCTCCTAGGAGG - Intronic
1002246069 5:177886313-177886335 GCCCAGAGCAGGCTCCTAGGAGG + Intergenic
1006175457 6:32118700-32118722 GGCCAAAGCAGGCAGCTAGGAGG + Intronic
1007715098 6:43851210-43851232 GCTCATAGCCCCCAGCGAGGCGG - Intergenic
1015507018 6:133999282-133999304 GATTAGAGCCGTGAGCTAGGAGG + Intronic
1019580418 7:1759175-1759197 GCTCAGGGCCGGCAGCCTGCAGG + Intergenic
1020107790 7:5430185-5430207 GCTGGGAGCCGGCAGGGAGGGGG - Intergenic
1022494125 7:30842698-30842720 GCTCAGGGCGGGCAGCCTGGTGG + Intronic
1030149628 7:106390497-106390519 ACTCAGAGCCAACACCTAGGTGG + Intergenic
1034132227 7:148730191-148730213 CCTCAGAGCCGGCATCCAGCAGG + Exonic
1034494175 7:151410179-151410201 GCGCAGCCCGGGCAGCTAGGAGG - Intronic
1035679495 8:1477536-1477558 CCTGAGAGCCGGCAGCCCGGTGG + Intergenic
1036643578 8:10598881-10598903 GCCCAGAGCCCACAGCCAGGAGG - Intergenic
1041097068 8:54360906-54360928 GCTTAGAGCCTGGAGCTAGATGG + Intergenic
1041167232 8:55102246-55102268 GCTCCGCGCAGGCAGCCAGGCGG + Intergenic
1045006126 8:97918359-97918381 GCTCAGGGCCGGCACATAGAAGG - Intronic
1047508543 8:125498458-125498480 GCTCAGAGACAGCAGCTACAGGG - Intergenic
1048999221 8:139814072-139814094 GCTCAGAGGCGGGAGCTCAGAGG - Intronic
1049225661 8:141449407-141449429 GCTCACAGCCCTCGGCTAGGAGG + Intergenic
1056747970 9:89321234-89321256 GCTCAAAGCCATCTGCTAGGTGG + Intronic
1057139557 9:92718359-92718381 GCTCAGGGCCCCCAGCTGGGAGG - Intronic
1057548249 9:96034002-96034024 GCTCAGAGCTGGCAGCCACCCGG - Intergenic
1060046990 9:120349172-120349194 CCTCAGAGGCGGCAGCTGGTGGG - Intergenic
1060745249 9:126126940-126126962 GCTCAGAGCCAGCAGCTGAATGG - Intergenic
1061087904 9:128409814-128409836 GCTCAGAGCTGGTACGTAGGAGG - Intergenic
1061960768 9:133987933-133987955 GTGCAGAGCCGGGTGCTAGGAGG - Intronic
1062544169 9:137054244-137054266 GCTCAGACCCGGGAGCCGGGGGG - Intergenic
1186519818 X:10195651-10195673 GCTCAGAGCTGGCAGGTTGGGGG - Intronic
1187040970 X:15595445-15595467 GCTAAGTCACGGCAGCTAGGAGG - Intronic
1189262327 X:39687680-39687702 GCTGACAGCAGGCAGCAAGGGGG + Intergenic
1190063266 X:47224114-47224136 GCTCAGAGCCGGCAGCTAGGTGG - Intronic
1199785331 X:151100136-151100158 GCACAGAGAAGGCAGCTGGGAGG + Intergenic
1199970676 X:152858462-152858484 GTTCAGAGCAGGCACCTAGGAGG - Intronic