ID: 1190063516

View in Genome Browser
Species Human (GRCh38)
Location X:47225424-47225446
Sequence TCGATTTCACGCGATGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 14
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 13}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190063516 Original CRISPR TCGATTTCACGCGATGCTGC AGG Intronic
1122000385 14:98646045-98646067 TCCATTTCTCACAATGCTGCAGG + Intergenic
1122087921 14:99320073-99320095 ACGTTGTCACGCCATGCTGCAGG - Intergenic
1149364459 17:55928278-55928300 TCCTTTTCACCCGATTCTGCTGG - Intergenic
1162337519 19:10071014-10071036 TCGGGTTCACAGGATGCTGCAGG + Intergenic
1173690097 20:44954004-44954026 TCGGTTTCACATGGTGCTGCAGG - Intronic
1183369961 22:37426896-37426918 TCTCTTTCACGGGGTGCTGCCGG - Intronic
956203569 3:66732667-66732689 TCGAATTCACACCATGATGCTGG + Intergenic
1000514998 5:162228528-162228550 TAGATTTCAGGCCATGCTCCAGG + Intergenic
1035176883 7:157057761-157057783 TGGATTTCTCTCCATGCTGCGGG - Intergenic
1035387870 7:158486250-158486272 TCGCTTTCACGCCCTGCTGGTGG - Intronic
1042427550 8:68665827-68665849 TTGATTTCACTCCATGCTCCTGG + Intronic
1053369823 9:37551410-37551432 TAGATTTCAAAGGATGCTGCAGG - Intronic
1054891906 9:70260036-70260058 TCGGTTTCAAGCGATTCTTCTGG + Intronic
1190063516 X:47225424-47225446 TCGATTTCACGCGATGCTGCAGG + Intronic