ID: 1190063744

View in Genome Browser
Species Human (GRCh38)
Location X:47226622-47226644
Sequence CCACAGTGTCACCACCTCAT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 1, 2: 1, 3: 11, 4: 143}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190063744_1190063754 11 Left 1190063744 X:47226622-47226644 CCAATGAGGTGGTGACACTGTGG 0: 1
1: 1
2: 1
3: 11
4: 143
Right 1190063754 X:47226656-47226678 TGACATCCTGCTTGGGTCCACGG 0: 1
1: 0
2: 1
3: 15
4: 135
1190063744_1190063749 4 Left 1190063744 X:47226622-47226644 CCAATGAGGTGGTGACACTGTGG 0: 1
1: 1
2: 1
3: 11
4: 143
Right 1190063749 X:47226649-47226671 GGCCCCCTGACATCCTGCTTGGG 0: 1
1: 0
2: 0
3: 16
4: 137
1190063744_1190063748 3 Left 1190063744 X:47226622-47226644 CCAATGAGGTGGTGACACTGTGG 0: 1
1: 1
2: 1
3: 11
4: 143
Right 1190063748 X:47226648-47226670 CGGCCCCCTGACATCCTGCTTGG 0: 1
1: 0
2: 2
3: 14
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190063744 Original CRISPR CCACAGTGTCACCACCTCAT TGG (reversed) Exonic
902584704 1:17431573-17431595 CTACAGTGTGATCACCCCATGGG + Intronic
903234719 1:21942349-21942371 CCACACTTTGACCACCTCAAGGG + Intergenic
903714721 1:25356386-25356408 CTCCAGTGTCACCTTCTCATGGG + Intronic
904137347 1:28323655-28323677 CCAAAGGCTCACCACCACATTGG - Intergenic
904279092 1:29405892-29405914 CCATAGTATCATCACCTCATGGG - Intergenic
904438028 1:30512005-30512027 TCACACTGACATCACCTCATAGG + Intergenic
905548300 1:38817248-38817270 CCTCAGTGTCCCCACCTCCAAGG + Intergenic
906710124 1:47923158-47923180 CCTGAGTGTCACCTCCTCAGAGG + Intronic
907769764 1:57449321-57449343 CCATATTGTCACCACATCAGTGG + Intronic
912078622 1:105909767-105909789 CCGCACTGTCAACGCCTCATGGG - Intergenic
912956962 1:114161157-114161179 CCACTCTGTGACCACCGCATAGG - Intergenic
916538257 1:165725651-165725673 CCACAGCATCACCAGATCATTGG - Exonic
917293223 1:173492857-173492879 CCACAGTGGCATAACCACATAGG - Intergenic
920379635 1:205528087-205528109 CCACAGGGTCACCACCTCATTGG - Exonic
920860931 1:209705898-209705920 CCTCGCTGTCACCACCACATGGG - Exonic
921612798 1:217232357-217232379 CTACAGAGCCACCACATCATGGG - Intergenic
922743631 1:228030852-228030874 CCACAGAATCATCAGCTCATGGG - Intronic
924606755 1:245541983-245542005 CCTCAATCTCACCACCTCGTTGG + Intronic
1065781503 10:29172775-29172797 CTACAGTGTCACCAGGTGATAGG + Intergenic
1066592464 10:37010345-37010367 CCACATTGTCACCTCCTGCTGGG - Intergenic
1069884215 10:71613394-71613416 CTACAGTGACACCCCCTCCTGGG + Intronic
1072705696 10:97679461-97679483 ACACAGTGTCACCACTTGGTTGG - Intronic
1074755452 10:116621141-116621163 CCTCAGGGTCCCCACCTCAAGGG + Intronic
1076933512 10:133551360-133551382 CCACCATGTCACCCCCCCATAGG - Intronic
1079390297 11:20016586-20016608 GCACAGTATCACCACTTCACTGG + Intronic
1081816010 11:45942436-45942458 CCAAAGGATCACCAGCTCATTGG - Intronic
1082814248 11:57497865-57497887 TCACGGTGTCCCCACCTCATGGG - Intronic
1085895889 11:80639026-80639048 CCACATTGTCACCTCCTGCTGGG + Intergenic
1086127845 11:83367869-83367891 CCTCTGTGTCACTCCCTCATGGG - Intergenic
1087055933 11:93936372-93936394 GCTCAGTTTCTCCACCTCATAGG - Intergenic
1092752406 12:11730946-11730968 CCCCAGTGTAACCCCCTCCTTGG + Intronic
1095784992 12:46100464-46100486 CCACATTGTCACCAGATCAATGG + Intergenic
1097136074 12:56856902-56856924 TCACAGTGTCATCACCCGATGGG + Intergenic
1097703935 12:62848607-62848629 CCAAAGTGTCACCACCACTTGGG - Intronic
1099804337 12:87498825-87498847 CCACCCCGTCACCACCTCATGGG - Intergenic
1100265775 12:92974461-92974483 CCTCAGTGTAATCACCTAATGGG + Intergenic
1103647232 12:122403922-122403944 ACACAGTGTCATCATGTCATCGG - Intronic
1104262480 12:127197223-127197245 CCACATTGTCAGCTCCTCAGAGG - Intergenic
1105617348 13:22030704-22030726 CCACAGTGTCACAGCCTGACTGG + Intergenic
1105700271 13:22930469-22930491 CCACTTTGCCACCACCTCAGAGG + Intergenic
1106030418 13:25997104-25997126 CCACCGTGCCCCCACCTTATAGG + Intronic
1109231893 13:59767182-59767204 CCACAGTAGCACCACCTCGTTGG + Intronic
1110226204 13:73122273-73122295 CCACCTTGTCACCACCTCAGGGG - Intergenic
1112544795 13:100356564-100356586 CCACATCTTCACCACTTCATGGG - Intronic
1113730297 13:112636864-112636886 CCTCACTGTCTGCACCTCATGGG + Intergenic
1114297450 14:21342402-21342424 CCACAGGTACACCACCACATAGG - Intronic
1115472064 14:33778337-33778359 TCACAGTGCCACCTCCTCACGGG + Intronic
1116688450 14:48073643-48073665 CCACGTTGTCAGCACCTCCTGGG - Intergenic
1117423892 14:55575673-55575695 TAACAGAGTAACCACCTCATAGG - Intronic
1117538257 14:56721880-56721902 CCACAGTGGCTCCGCCTCACTGG - Intronic
1118680334 14:68235251-68235273 CTACAGTGTCACTACATGATAGG + Intronic
1121747858 14:96315011-96315033 CTACGGTGTCACCACCTTTTAGG - Intronic
1122719487 14:103714326-103714348 CCACAGGGACCCCACCTCACAGG + Intronic
1123117297 14:105900492-105900514 CCACAGTGTCCCCACTGGATGGG - Intergenic
1123119387 14:105909761-105909783 CCACAGTGTCCCCACTGGATGGG - Intergenic
1123843010 15:24268473-24268495 ACACAGTGTAACCACCTAGTGGG - Intergenic
1128116767 15:65112474-65112496 GCACATGGGCACCACCTCATGGG - Intronic
1129780869 15:78270102-78270124 CCACTGGCTCACCTCCTCATGGG - Intronic
1133201722 16:4207839-4207861 CCACAGAGTCACCTCCACCTGGG - Intronic
1133877073 16:9744994-9745016 ACACAATGTCACCAGCTCCTGGG + Intergenic
1137764225 16:50965463-50965485 CTGCAGAGTCACCACATCATAGG - Intergenic
1141833943 16:86525874-86525896 TAACAGTGTCACCACCTCGGTGG + Intergenic
1142532795 17:594341-594363 GCACATTGTCAACACCGCATGGG + Intronic
1145942221 17:28748555-28748577 CCACAGTGCCCACACCACATTGG - Exonic
1146723050 17:35136788-35136810 CCAGAGTGTGACGATCTCATGGG + Intronic
1148988432 17:51644659-51644681 CCACAGTCTCCCCATCTCAGTGG + Intronic
1151091872 17:71449500-71449522 CCACAGTGTCCACACCTTCTGGG + Intergenic
1151364381 17:73607593-73607615 GCTCAGTGTCACCTCCTCAGTGG - Intronic
1151744145 17:76002503-76002525 CCACAGTGTCACCACCTGCAGGG - Exonic
1152445421 17:80339976-80339998 CAACAGTGCCACCTCCTCAAAGG - Exonic
1155007565 18:21741717-21741739 CCACACTACCACCACCTCCTCGG - Exonic
1157544711 18:48539533-48539555 CCACAGTGTCGCCCCCTCCCTGG + Intronic
1157549056 18:48568351-48568373 CCAATGTTTCCCCACCTCATGGG - Intronic
1158605231 18:58890055-58890077 ACACAGTCTCACCATCTCCTAGG - Intronic
1158653272 18:59306808-59306830 CCCCAGGGTCACCACCACAGCGG - Intronic
1159989615 18:74888988-74889010 ACACAGTGTTATAACCTCATAGG - Intronic
1160628607 18:80230009-80230031 TCACAGTGTCACCATTTCAGAGG + Intronic
1160754199 19:749206-749228 CCACAGTGCCCCCAGCTCATGGG + Intergenic
1161395744 19:4044061-4044083 CCTCAGTGTCACCACCTGTGAGG + Intergenic
1163757670 19:19116156-19116178 CCACAGTGTCACCTGCTCATTGG + Intergenic
1165152223 19:33767504-33767526 CCACAGTGTGAACTCTTCATTGG - Intronic
1166719135 19:44987535-44987557 CCACAGTTTCACAACCTCCCAGG + Intronic
1168702428 19:58449186-58449208 CCACAGGCTCAACACCACATGGG - Intergenic
925703846 2:6665501-6665523 CACCAGTGACACCACCTCCTAGG - Intergenic
926431040 2:12785957-12785979 CCACAGGCTCAACACCACATAGG + Intergenic
927258962 2:21067492-21067514 TCACAGTATCACCACTTCAATGG - Intergenic
933022337 2:77209364-77209386 CCACAGTGTTAGCTCCTAATTGG + Intronic
944477264 2:200119607-200119629 CTACAGTGGCAGCACCTCATGGG - Intergenic
947874896 2:233461504-233461526 CCGCAGTGGCACCAACTCCTGGG - Intronic
1168966470 20:1901499-1901521 ACACACTGCCCCCACCTCATAGG - Intronic
1170001958 20:11624656-11624678 CTGCAGTGTTACCAACTCATGGG + Intergenic
1171961860 20:31500494-31500516 CCACAGTCTAGCCACCTCTTCGG + Intergenic
1172128176 20:32637649-32637671 CTACAGTGTCAGCTCCACATGGG + Intergenic
1175178054 20:57125601-57125623 GCACAAGGTCACCACCTCCTGGG - Intergenic
1180305207 22:11067796-11067818 CCACAGTGTCCGCAGCTCCTTGG - Intergenic
1181126799 22:20707521-20707543 CCACAATCTCACCACGGCATAGG - Intergenic
1184808539 22:46812474-46812496 CCACAGTGTGACCAACCCGTGGG - Intronic
950725866 3:14916624-14916646 TCACAGTGTAACCACCACCTGGG + Intronic
950779789 3:15381462-15381484 ACAAAGTTTCACCACCTCCTTGG - Exonic
951359659 3:21710344-21710366 CCCCAGTCTCACCAGATCATTGG - Intronic
951736530 3:25871811-25871833 CTACAGTGTGACCATCTTATGGG - Exonic
954203451 3:49039546-49039568 GCACACTGCCACCACCTCCTGGG - Intronic
954215832 3:49124046-49124068 CCTCAGTGTCACCGCTTCACAGG - Exonic
954827486 3:53386998-53387020 CCATATTGACACCACCTCAATGG + Intergenic
957639562 3:82834274-82834296 CCACAGTGTCAAGAGTTCATAGG + Intergenic
963390715 3:144660273-144660295 CCTCAGTATCACTACCTCTTAGG + Intergenic
965409071 3:168306863-168306885 TCACAGTGTCACCTCTTCACTGG + Intergenic
966332492 3:178829973-178829995 CCACCGTGTAACCACCTTAAGGG + Intronic
968656371 4:1780087-1780109 CCTCAGTCTCCACACCTCATCGG + Intergenic
969121294 4:4913421-4913443 CAACAGTGCCACCCCCTGATTGG + Intergenic
971146339 4:23980700-23980722 CCACAGACTCTCCACCACATAGG + Intergenic
971957436 4:33440107-33440129 CCACAGTGGCACCACAGCAGTGG - Intergenic
978889783 4:113811088-113811110 CCACAGAGTCATCGCCACATTGG + Intergenic
980485633 4:133454416-133454438 CCACAGTCACACCACCTCCCAGG + Intergenic
981694270 4:147543888-147543910 CCACATTGTCACCATTTCAAAGG + Exonic
986559904 5:9050114-9050136 CCACAGAATCAGGACCTCATGGG - Intronic
986767131 5:10938283-10938305 TCACACGGGCACCACCTCATAGG + Intergenic
991279982 5:64902286-64902308 CTACAGTGTCACCAGGTGATAGG + Intronic
992495249 5:77286442-77286464 CCACAGTCACACCACGGCATGGG - Intronic
992954024 5:81889644-81889666 ACACAATGTCAGCACCTCACTGG - Intergenic
996584106 5:125065527-125065549 CCAATGTGTCAACACTTCATTGG + Intergenic
1001078174 5:168645292-168645314 CCACAGTGTTACCAGGTGATAGG - Intergenic
1004132833 6:12937270-12937292 CCACACTGCCACCATCTCAAAGG + Intronic
1014248891 6:119096105-119096127 ACCCAATGTCACCACCTCAAAGG - Intronic
1014406991 6:121064673-121064695 CCACAGGCTCAACACCACATGGG - Intergenic
1015829310 6:137350752-137350774 TAACAGTGGCACCACCTCACAGG + Intergenic
1019547224 7:1584322-1584344 CTACAGAGCCCCCACCTCATTGG + Intergenic
1019653224 7:2172101-2172123 CAACAGTGCCCCCACCTCAAAGG + Intronic
1019857087 7:3620173-3620195 CCACCGTATCACAACCTCAGAGG - Intronic
1022487132 7:30787743-30787765 CCACAGTGTCCCCAGCAGATGGG - Intronic
1023041375 7:36175935-36175957 ACACAGAGTCATCACCTCACAGG - Intronic
1024626347 7:51211151-51211173 ACACATTCTCACCACCTCCTGGG + Intronic
1026744930 7:73004371-73004393 CCCCAGGGTCACCACCTCCCAGG - Intergenic
1027031035 7:74889038-74889060 CCCCAGGGTCACCACCTCCTAGG - Intergenic
1027098810 7:75360711-75360733 CCCCAGGGTCACCACCTCCCAGG + Intergenic
1028263530 7:88693918-88693940 GAAAAGTATCACCACCTCATAGG - Intergenic
1029009897 7:97248621-97248643 CCACACTGTGACCATCTCAGTGG + Intergenic
1029399909 7:100337514-100337536 CCCCAGGGTCACCACCTCCCAGG + Intronic
1029716948 7:102333988-102334010 CCCCAGGGTCACCACCTCCCAGG - Intergenic
1035013866 7:155746006-155746028 ATACAGTGTCATAACCTCATGGG + Intronic
1035078152 7:156194626-156194648 GCACAGTGCCAGTACCTCATAGG + Intergenic
1036095094 8:5715376-5715398 CCACAGTTTCACCTCGTCACAGG + Intergenic
1038050001 8:23799773-23799795 ACACAGTGTTATCACGTCATAGG - Intergenic
1040576541 8:48656673-48656695 CCACCGTGTCACCTCCACAGTGG + Intergenic
1044934736 8:97282781-97282803 CCACACAGTGACCACCACATGGG + Intergenic
1050106606 9:2172527-2172549 TCTCAGTGTGACCAGCTCATTGG + Intronic
1186048569 X:5563739-5563761 ACACATTGTCCCCACCTCACAGG + Intergenic
1187931574 X:24298176-24298198 CCACAGTGTCACCCATACATTGG + Intergenic
1188445312 X:30248555-30248577 CCTCAGTGTCACCATCTTTTAGG - Intronic
1189803031 X:44709184-44709206 CCACAGTTTCACCACCCAATAGG + Intergenic
1190063744 X:47226622-47226644 CCACAGTGTCACCACCTCATTGG - Exonic
1194274691 X:91865263-91865285 TCACAGAGGCACCACCTCAATGG + Intronic
1195070186 X:101271732-101271754 CCACAGTGTCACCAGGTGACAGG + Intronic
1195644682 X:107215918-107215940 ACATAGCGACACCACCTCATTGG - Intronic
1199492568 X:148417152-148417174 TCATGGTGTCAACACCTCATCGG + Intergenic
1200591934 Y:5086664-5086686 TCACAGAGGCACCACCTCAATGG + Intronic
1202586097 Y:26429398-26429420 CAACAGTTTCTCCACCTCTTCGG - Intergenic