ID: 1190063928

View in Genome Browser
Species Human (GRCh38)
Location X:47227424-47227446
Sequence TCCCCCAGACTGAGGAAGAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 1, 2: 1, 3: 20, 4: 304}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190063928_1190063934 15 Left 1190063928 X:47227424-47227446 CCATTCTTCCTCAGTCTGGGGGA 0: 1
1: 1
2: 1
3: 20
4: 304
Right 1190063934 X:47227462-47227484 TCCTGACAGTGAGTGGAGCTGGG 0: 1
1: 0
2: 1
3: 22
4: 219
1190063928_1190063938 26 Left 1190063928 X:47227424-47227446 CCATTCTTCCTCAGTCTGGGGGA 0: 1
1: 1
2: 1
3: 20
4: 304
Right 1190063938 X:47227473-47227495 AGTGGAGCTGGGGAATGGACCGG 0: 1
1: 0
2: 1
3: 44
4: 402
1190063928_1190063932 8 Left 1190063928 X:47227424-47227446 CCATTCTTCCTCAGTCTGGGGGA 0: 1
1: 1
2: 1
3: 20
4: 304
Right 1190063932 X:47227455-47227477 ACAAACTTCCTGACAGTGAGTGG 0: 1
1: 0
2: 3
3: 14
4: 168
1190063928_1190063936 16 Left 1190063928 X:47227424-47227446 CCATTCTTCCTCAGTCTGGGGGA 0: 1
1: 1
2: 1
3: 20
4: 304
Right 1190063936 X:47227463-47227485 CCTGACAGTGAGTGGAGCTGGGG 0: 1
1: 2
2: 2
3: 41
4: 380
1190063928_1190063933 14 Left 1190063928 X:47227424-47227446 CCATTCTTCCTCAGTCTGGGGGA 0: 1
1: 1
2: 1
3: 20
4: 304
Right 1190063933 X:47227461-47227483 TTCCTGACAGTGAGTGGAGCTGG 0: 1
1: 0
2: 1
3: 22
4: 225
1190063928_1190063937 21 Left 1190063928 X:47227424-47227446 CCATTCTTCCTCAGTCTGGGGGA 0: 1
1: 1
2: 1
3: 20
4: 304
Right 1190063937 X:47227468-47227490 CAGTGAGTGGAGCTGGGGAATGG 0: 1
1: 0
2: 8
3: 81
4: 639

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190063928 Original CRISPR TCCCCCAGACTGAGGAAGAA TGG (reversed) Exonic
900605338 1:3521274-3521296 GCCCCCACACTGAGGCAGGAAGG + Intronic
902609639 1:17589472-17589494 TGCCCCAAACTGAGCAAGAGGGG + Intronic
902919368 1:19657095-19657117 CCCCCCACACAGAGGAAGAGGGG + Exonic
903237891 1:21962121-21962143 TCTGCCAGGCTGAGCAAGAAGGG - Intergenic
903370582 1:22832582-22832604 CCACCCAGACTGAAGAAGAGTGG - Intronic
904375418 1:30078581-30078603 TCCCTCAGAGTCAGGAAGCAGGG + Intergenic
904629762 1:31832060-31832082 TTCCCCAGATGGAGGAAGGAAGG - Intergenic
905121998 1:35689453-35689475 TCCCCCAGGCTGGGGTACAATGG - Intergenic
905166177 1:36084471-36084493 GCCCGCAGCCTGGGGAAGAAAGG + Intronic
905947606 1:41917150-41917172 TCCCCCAGACTGAAGAAGTTGGG - Intronic
906065420 1:42977125-42977147 TCACCCAGACTGGAGAACAATGG + Intergenic
906221732 1:44085762-44085784 TCACCCAGACTGAAGCACAATGG - Intergenic
906940822 1:50253610-50253632 CCCCACTTACTGAGGAAGAATGG + Intergenic
907440908 1:54477557-54477579 TCCCCCCGACAGAGATAGAAAGG - Intergenic
907481141 1:54746329-54746351 TCCCCCATCCTGTGGAAAAATGG + Intergenic
907603951 1:55796991-55797013 TCACCCAGACTGAGGTACAGTGG - Intergenic
907637554 1:56151183-56151205 TCCCCAGGACTGAGGATGCAAGG + Intergenic
908260655 1:62337410-62337432 TCCCACAGCCTAAGGAAGGAGGG + Intergenic
909348475 1:74620524-74620546 TCTCGCAGATTGTGGAAGAAAGG - Intronic
909450737 1:75795727-75795749 TGCCCCAGCCTGGGGAAGAAAGG - Intergenic
910456385 1:87401698-87401720 TTTCCCAGACTGAAGAAAAAAGG - Intergenic
910522653 1:88140218-88140240 TCCCCAAGATTTAAGAAGAAAGG - Intergenic
911521068 1:98931557-98931579 TCCCCAAGGCTGAGGGAGAAAGG - Intronic
911662831 1:100522884-100522906 TCCCACAGACTTGAGAAGAAAGG + Intergenic
912614651 1:111085859-111085881 TTCCCCAGCCTGAGGATAAAAGG + Intergenic
914453149 1:147811212-147811234 TTCCCAAGACGGAGGAAGTATGG + Intergenic
915011007 1:152686250-152686272 TCTGCCATACTGAGGAGGAATGG + Intronic
917030200 1:170682132-170682154 TGGCTCAGAATGAGGAAGAAAGG + Intronic
917259244 1:173148929-173148951 TCCCACCCAGTGAGGAAGAATGG + Intergenic
917823051 1:178786112-178786134 TCGAGTAGACTGAGGAAGAAGGG + Intronic
918017026 1:180645223-180645245 ACCCCCAAACTGGGAAAGAATGG - Intronic
919570453 1:199242468-199242490 TCCACCATTCTGAGGAAGGAAGG + Intergenic
920315646 1:205074211-205074233 TCCTTCAGTCTAAGGAAGAAGGG + Exonic
920701954 1:208224686-208224708 TGCCCCAGAGTGAAGAAGGAAGG + Intronic
921685268 1:218082525-218082547 TGCCCGAGGCTGTGGAAGAAAGG - Intergenic
921807933 1:219477494-219477516 TCCCCCATACAGAGGAAGGATGG + Intergenic
921875634 1:220192464-220192486 TCTCCCTGACTAAGAAAGAAGGG - Intronic
923045498 1:230352791-230352813 TCCCCCACACAGTGGGAGAATGG + Intronic
923615004 1:235530169-235530191 TCCCTCTGCCTGAGAAAGAAGGG - Intergenic
924851238 1:247833409-247833431 TTCCACAGACTGAAGACGAAGGG + Intergenic
1062975537 10:1679845-1679867 ACCCACAGACTAAGGAGGAACGG - Intronic
1063347144 10:5322618-5322640 TCACCCAGACTGAAGTAGAGTGG - Intergenic
1066525116 10:36269481-36269503 TAACCCAGACTGAAGAGGAAAGG + Intergenic
1066596421 10:37055147-37055169 ACTCCCAGGCTGAGGAAAAAAGG + Intergenic
1067050604 10:43016388-43016410 TACCCAAGACTGAGAAAAAAAGG - Intergenic
1067663325 10:48252612-48252634 TCCTCCAGCCTCAGGAAGAGAGG + Intronic
1069577450 10:69541011-69541033 ATCCCCAGACTGAGGAACAGAGG + Intergenic
1069626230 10:69869251-69869273 GCCCACAGAGTGAAGAAGAAAGG + Intronic
1070289343 10:75104514-75104536 GGCCCCAGGCTGAGGGAGAAGGG + Intronic
1071219952 10:83454028-83454050 TCTCTCAGACTAAGCAAGAAGGG + Intergenic
1071675065 10:87647669-87647691 TCACCCTGAGTGTGGAAGAAAGG - Intergenic
1073249435 10:102112760-102112782 GCCCCTAGACTGAGGAACATAGG - Intronic
1074492474 10:113951531-113951553 TCTCCCAGACTGAAGTACAATGG + Intergenic
1074955137 10:118381180-118381202 TCCCTCAGGCTGGGGAAGCATGG - Intergenic
1074977018 10:118589182-118589204 TCCCCTTCACTGAGGCAGAAGGG + Intergenic
1074998815 10:118779978-118780000 TCCACAAGACTGATGAAGAGAGG - Intergenic
1075027285 10:118994637-118994659 ACCCCCAGGCAGAGGAAGAGAGG - Intergenic
1076534741 10:131169357-131169379 GCCCCCTGACTGAGGCACAAGGG + Intronic
1077179115 11:1204326-1204348 TCCCCCAGGCTGATGGAGAAGGG + Intergenic
1077779957 11:5316692-5316714 TCTCCCAGACAGAGGAGGGAGGG - Intronic
1080600888 11:33819818-33819840 TGCCCCTGGCTGAGGAAGGAGGG - Intergenic
1080797310 11:35576606-35576628 TCACCCAGGCTGAAGTAGAATGG - Intergenic
1081344223 11:41962461-41962483 TACCACAGACTGAGGAATAGGGG - Intergenic
1082897173 11:58204444-58204466 TCCCCCAAACTGAGGATCATAGG + Intergenic
1082902937 11:58275849-58275871 TCCCCCAGAGAGATGATGAATGG - Intergenic
1083757356 11:64798823-64798845 TCCCCCAGTGGGAGGAAGAGTGG - Exonic
1084448800 11:69220396-69220418 TCACCCAGTCTTAGGAAGTAGGG + Intergenic
1086021818 11:82239608-82239630 TCCCGCCCAGTGAGGAAGAATGG + Intergenic
1086449837 11:86905014-86905036 TCCCCCAGACTGAAGTACAGTGG - Intronic
1086563782 11:88200383-88200405 TTCCGCAAACTGATGAAGAAAGG + Intergenic
1088084436 11:105960338-105960360 CCCCGCCCACTGAGGAAGAATGG + Intronic
1089126269 11:116178638-116178660 CGCCCCAGAGTGAGGAAGATGGG - Intergenic
1089273513 11:117316922-117316944 TCAGCCAGACTGAGGAGAAATGG + Intronic
1089932724 11:122330299-122330321 TCTCATAGACTTAGGAAGAAAGG - Intergenic
1090535285 11:127634470-127634492 TTCCCAAGACTGAGGTAAAAAGG - Intergenic
1090884163 11:130861597-130861619 TCCCCCAGCCTGGGGAAGCTGGG - Intergenic
1092101157 12:5884814-5884836 TCCCACAGCATGATGAAGAAGGG + Intronic
1092502993 12:9065818-9065840 TCCCCCAGACTCAGCTAGATTGG + Intergenic
1092515001 12:9202248-9202270 TCACCCAGAGTGAGGTAGAAAGG - Intronic
1093214612 12:16348359-16348381 TCCTCCAGACTGGGGAAGTGGGG - Intronic
1093382932 12:18517271-18517293 TTCCCCAGACTGAGAAACAATGG - Intronic
1093641468 12:21531607-21531629 TCCCCAAGAATGTGGAAGGAAGG + Exonic
1095924428 12:47564188-47564210 TCCCCCAGACTGGGGTACAGAGG + Intergenic
1096257060 12:50069647-50069669 TGCCCCAGACTGGGGAATTAAGG - Intronic
1096771894 12:53940395-53940417 TGCCCCAGACACAGAAAGAAGGG + Intronic
1097521146 12:60672498-60672520 TCCCACACAATGAGGAGGAATGG + Intergenic
1098005418 12:65992133-65992155 TCCATCAGACTATGGAAGAAGGG + Intergenic
1099530422 12:83772668-83772690 TTCCCCAGACTGGGAAACAATGG + Intergenic
1099793255 12:87363399-87363421 TCCCACCCACTGAGGAAGGATGG + Intergenic
1099916524 12:88901828-88901850 TCCTGTAGACTGATGAAGAAAGG - Intergenic
1100605876 12:96151586-96151608 TCCCCCAGACTGAAGTGCAATGG - Intergenic
1101959501 12:109237970-109237992 TCCCCCAGGCTGAAGTACAAGGG - Intronic
1102231560 12:111265995-111266017 TGCCCCAGACAGAGGAACAGTGG - Intronic
1103730044 12:123021369-123021391 TCCCCCAGGCTGAAGTACAATGG + Intronic
1104149692 12:126070795-126070817 TCTCCCTGACTGTGGAGGAAAGG + Intergenic
1105962680 13:25356231-25356253 TCCTCAGCACTGAGGAAGAATGG + Intergenic
1109857569 13:68152553-68152575 TCACCCAGCCTGAGGAGAAAGGG - Intergenic
1110316556 13:74115020-74115042 TCCCACAGACTGGGAAAGAGTGG - Intronic
1111235239 13:85400630-85400652 TCCCACCCACTAAGGAAGAATGG + Intergenic
1111924237 13:94445913-94445935 CCCCCAACACTGAGGAAGAATGG - Intronic
1114534474 14:23414088-23414110 GCCCCCAGACGGAGGAGGACAGG - Exonic
1116405204 14:44558067-44558089 TCCTCCAACCTGTGGAAGAAGGG - Intergenic
1116741074 14:48755488-48755510 TTCCCCAGACTGGGAAACAATGG - Intergenic
1117177734 14:53162498-53162520 TCCCCCAGACTGGAGTACAATGG + Intergenic
1117851536 14:59976295-59976317 TCCCCCAGACTGGGGATGGGAGG - Intronic
1118447631 14:65866279-65866301 TCTCTCAGGCTGAGGAAGAGGGG + Intergenic
1118774697 14:68966507-68966529 TCCCCCAGGAACAGGAAGAATGG - Intronic
1119148500 14:72337291-72337313 TACCCCTGACTTAAGAAGAAAGG - Intronic
1120965691 14:90165592-90165614 TCCCTCAGACTGAGAAGAAATGG - Intronic
1121910033 14:97781804-97781826 CACCCCAGGCTGAGGAGGAATGG + Intergenic
1122858289 14:104570625-104570647 TCCCCCAGACAGAAGAGCAAAGG + Intronic
1125514430 15:40309718-40309740 CCCCTCAGCCTGAGGAGGAAAGG + Intergenic
1125663377 15:41412010-41412032 TCCCCCAGACTGGAGTACAATGG - Intronic
1126440088 15:48678233-48678255 TATCCCAGCCTGAGGAGGAAGGG - Intergenic
1127813895 15:62589589-62589611 TCCCCCACACTAAGCATGAAAGG - Intronic
1127966874 15:63929241-63929263 TCCCCCAGACTGAGGTATACTGG - Intronic
1128048914 15:64645122-64645144 TACTCCAGCCTGAGGAAGGAAGG - Intronic
1128881628 15:71248306-71248328 TCCCCAAGACAAAGGCAGAAAGG - Intronic
1129711768 15:77824000-77824022 TCCCCCAGAACTATGAAGAATGG + Intergenic
1130208779 15:81903525-81903547 TCCCCAAATCTGGGGAAGAAAGG - Intergenic
1130339212 15:82985176-82985198 TACCACTGACTGAGGGAGAATGG + Intronic
1131627239 15:94134411-94134433 TTCCCCAGGCTGATGAAGACTGG + Intergenic
1132669115 16:1095471-1095493 TCCCCCAGACTAGGGAAGGATGG + Intronic
1133046005 16:3088742-3088764 CCACCCAGAATGAGGGAGAAGGG - Intergenic
1133197980 16:4184312-4184334 TCCCTCAGACGAAGGAAGAGTGG + Intergenic
1134654901 16:15940769-15940791 TCGCCCAGACTGAAGTACAATGG - Intergenic
1135984806 16:27176324-27176346 TCCACCTGACAGAGGAAGCAAGG + Intergenic
1136094266 16:27943612-27943634 TCACCCAGACTGAAGTGGAATGG + Intronic
1136244602 16:28967192-28967214 TACCACAGAAGGAGGAAGAATGG - Intergenic
1136519663 16:30787275-30787297 TCCCGCAGCCTGGGGAAAAAAGG + Intergenic
1137521660 16:49200379-49200401 TCCTTCAGACAGAGGGAGAAAGG - Intergenic
1137639239 16:50013850-50013872 ACCCCCAGACTGAGGAAGAAGGG + Intergenic
1139196473 16:64924644-64924666 TCACACAGAGTGAGGTAGAAGGG - Intergenic
1142028185 16:87825402-87825424 TCCCCCAGAGAGAGGATGAGGGG - Intergenic
1142716119 17:1747888-1747910 TGGCCCAGACTGAGGAAGAAAGG - Intronic
1143863057 17:9905174-9905196 TCCCCATGAGTGAGGAAGAGTGG + Exonic
1144876492 17:18399932-18399954 ACCCCCGGACTGGGGAAGCAGGG - Intergenic
1145155734 17:20544488-20544510 ACCCCCGGACTGGGGAAGCAGGG + Intergenic
1146396792 17:32474283-32474305 CCACCCAGAATGAGGAAGGAAGG + Intronic
1148888224 17:50788868-50788890 TCCCCCACACTGTGGAAGGTGGG - Intergenic
1149834363 17:59899162-59899184 TCCCCCAGGCTGGAGAACAATGG - Intronic
1151249356 17:72821742-72821764 TCCCTCAGACTGAGGCAAAAGGG + Intronic
1152250109 17:79208066-79208088 CCCTCCAGACGCAGGAAGAAGGG - Intronic
1152515292 17:80819984-80820006 TCCCCAAGCCTCAGGAAGAGAGG - Intronic
1152866824 17:82729132-82729154 TTCCACAGGGTGAGGAAGAATGG - Intronic
1154056127 18:11014876-11014898 TTCCCCACACTGAGGAATGAGGG - Intronic
1154056163 18:11014989-11015011 TTCCCCACACTGAGGAATGAGGG - Intronic
1154056178 18:11015046-11015068 TTCCCCACACTGAGGAATGAGGG - Intronic
1154056210 18:11015159-11015181 TTCCCCACACTGAGGAATGAGGG - Intronic
1154056228 18:11015217-11015239 TTCCCCACACTGAGGAATGAGGG - Intronic
1155326630 18:24671293-24671315 TCTTTCAGGCTGAGGAAGAAAGG + Intergenic
1155389810 18:25323071-25323093 TCCCAAAGAGGGAGGAAGAAAGG + Intronic
1156490556 18:37493487-37493509 TCACCCAGCCAGAGGCAGAATGG - Intronic
1156784806 18:40897899-40897921 TCCCCCATACTGGGGGAGGAGGG + Intergenic
1156802665 18:41136727-41136749 TCCCCCAGACTTAAGAAGTGTGG + Intergenic
1157044240 18:44079656-44079678 TCACCCAGAAGGATGAAGAAAGG + Intergenic
1157557146 18:48620294-48620316 TGCCACAGACTGAGGCAGGAGGG - Intronic
1158230027 18:55244138-55244160 TCCACCAGTCTGAAGATGAAAGG - Intronic
1159322284 18:66867329-66867351 TCCCAGAGACTGAAGAAAAAAGG - Intergenic
1161224278 19:3136027-3136049 TTCTCCAGAAGGAGGAAGAAGGG + Intergenic
1161716179 19:5877295-5877317 TCCCCCAGGCCCAGGTAGAAGGG - Intronic
1162770122 19:12944324-12944346 CCCCCAGCACTGAGGAAGAACGG + Exonic
1162772468 19:12957308-12957330 TCCCCCGAACTGAGGCAGCAGGG - Intergenic
1163069322 19:14825189-14825211 TCACCCAGACTGAAGTAGAGTGG - Intronic
1164063967 19:21697967-21697989 TCCCCCAGGCTGAAGTACAATGG - Intergenic
1164102999 19:22075520-22075542 TCTCCCAGACTGCGGCTGAAAGG + Intronic
928040386 2:27870063-27870085 CCCCCCAGACTGGGAAGGAATGG - Intronic
928669188 2:33583344-33583366 TCCCCCAATCTTAGGAAGAATGG + Intergenic
929087971 2:38187191-38187213 TCCCCCAGAGAGAAGAATAAGGG + Intergenic
929250242 2:39746216-39746238 TGCCCAAGAATGAGGGAGAAGGG - Intronic
929927380 2:46225889-46225911 ATCCCCAGAATGATGAAGAAAGG + Intergenic
931434496 2:62235103-62235125 TAACCCCGACTGAGGAAGGAGGG - Intergenic
931676430 2:64701289-64701311 TCATCCAGACTGAGAAAAAAGGG - Intronic
931813018 2:65873218-65873240 TCCCTGAGACTTAGGAGGAAGGG + Intergenic
932342571 2:70975585-70975607 CCTCCCTGACTGAGGCAGAAAGG + Intronic
932382861 2:71301563-71301585 TCACCCAGACTGGGGTACAATGG + Intronic
932875733 2:75449406-75449428 TCACCCAGACTGAAGCACAATGG - Intergenic
933214703 2:79616939-79616961 TCACCCAGGCTGGGGTAGAATGG + Intronic
934684123 2:96307998-96308020 TTCCGCAGAGTGAGGAAGCACGG - Intergenic
935619537 2:105116853-105116875 TGCCCCGGACTGAGGCATAAAGG - Intergenic
935929938 2:108113395-108113417 TCCCACCCAGTGAGGAAGAATGG + Intergenic
936146688 2:109985040-109985062 TTCCCCAGAAGGAGGCAGAATGG - Intergenic
936198004 2:110386439-110386461 TTCCCCAGAAGGAGGCAGAATGG + Intergenic
936689901 2:114874202-114874224 ACCCCCAGACTGGGAAGGAATGG + Intronic
937343160 2:121104801-121104823 TCCCCAAGACAGAGGCAGAGTGG - Intergenic
937695133 2:124800535-124800557 GCCACCAGACTGAGGAAGGGAGG - Intronic
938576560 2:132609649-132609671 TGCCCCAGTATGAGGAAGGATGG - Intronic
943229689 2:185233055-185233077 TGCCACAGAATAAGGAAGAATGG + Intergenic
945599601 2:211843485-211843507 TACCACAGACTGAGAAAGATTGG + Intronic
946190128 2:218003557-218003579 GGCCCGAGACTGGGGAAGAATGG + Intergenic
948429393 2:237909508-237909530 GCCCTGAGACTCAGGAAGAAAGG - Intronic
948635073 2:239329531-239329553 TCCCCCAGCCGGAGCAGGAATGG - Intronic
948635138 2:239329930-239329952 TCCCCCAGCCGGAGCAGGAATGG + Intronic
948756815 2:240164897-240164919 TTCCCCAGCCAGAGGAAGAAGGG + Intergenic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1169058485 20:2642910-2642932 TCCCCCAGACTCAGAAAGTCAGG + Intergenic
1169927336 20:10796539-10796561 TCCCCCAGGCTGAAGTACAATGG + Intergenic
1170512963 20:17097867-17097889 TCCCTCAGATTGATGAGGAAAGG - Intergenic
1172299510 20:33839173-33839195 TCCTCCAGAATGTGGAGGAAAGG + Intronic
1172508258 20:35480057-35480079 TGGCCCAGGCTGAGCAAGAAGGG + Exonic
1173430180 20:42980931-42980953 TCTCCCAGTCTGCGGAAGAGTGG + Intronic
1174304396 20:49604806-49604828 TCCCCCATGCAGATGAAGAACGG - Intergenic
1174907863 20:54571651-54571673 TTCCCCAGACTGAGGACCACTGG + Intronic
1175176511 20:57115547-57115569 TCCCACAGACGCAGGAACAAGGG + Intergenic
1177643768 21:23876634-23876656 TCCCCCAGACTGGGGTGCAATGG - Intergenic
1177862896 21:26475465-26475487 TCCTTAAGTCTGAGGAAGAAAGG - Intronic
1180096377 21:45557145-45557167 TGCCCAGGACTCAGGAAGAACGG + Intergenic
1180756583 22:18166131-18166153 TTCTCCAGACTGAGGACGGAAGG - Intronic
1181075186 22:20371302-20371324 TTCTCCAGACTGAGGACGGAAGG + Intronic
1181376188 22:22460067-22460089 TCCCCCATACAGAGGGAGGAGGG + Intergenic
1181376772 22:22465065-22465087 TCCCCCATAGAGAGGGAGAAGGG + Intergenic
1181627369 22:24130956-24130978 TCCCCCAGATTGGAGCAGAAAGG - Intronic
1182194894 22:28506063-28506085 TCCCGCCCAGTGAGGAAGAATGG - Intronic
1182423326 22:30259089-30259111 TCCATCAGACAGAGGCAGAACGG - Intergenic
1182541866 22:31047642-31047664 GTCCCCAGAAAGAGGAAGAAGGG + Intergenic
1182624748 22:31637720-31637742 TTCCCCAGACTGAGTCAGCATGG - Intronic
1183751914 22:39725764-39725786 TCTTGCAGACTGAGGAAGGAGGG + Intergenic
1185184043 22:49381929-49381951 TCCCCCAGACTGTGCACGGAAGG - Intergenic
1185190900 22:49435337-49435359 GCCCCCAGAACGAGGAGGAAAGG - Intronic
949831354 3:8218042-8218064 TCCTTCAGCCTGAGGAAGGAAGG + Intergenic
950993651 3:17469591-17469613 TACACCAGAATGAGGAATAAAGG + Intronic
953303368 3:41802335-41802357 TCACCCAGACTGAAGTACAATGG + Intronic
953826216 3:46253144-46253166 TCCCCCAGAGGGAGGAAGATTGG - Intronic
954449145 3:50562380-50562402 TCCCCAGGGCTGAAGAAGAAAGG + Intronic
955470966 3:59285860-59285882 TCCACCAGACTCAGGAGCAATGG - Intergenic
957611004 3:82466575-82466597 TCCCCCATATCAAGGAAGAAAGG + Intergenic
959491611 3:106996366-106996388 TACCAGAGACTGAGGAGGAAAGG + Intergenic
960752449 3:120971031-120971053 TTCCCCAGACTGGGAAACAATGG - Intronic
963464214 3:145658208-145658230 TTCCCCAGACTGAGAAGCAATGG - Intergenic
964186821 3:153955527-153955549 TTTCCCAGAATGAGAAAGAATGG + Intergenic
968167427 3:196478704-196478726 TCGCCCAGACTGAAGTACAATGG + Intronic
969070586 4:4535080-4535102 TCCACCAGACGTAGGTAGAAGGG - Intronic
969427940 4:7136838-7136860 TGCCCCAGGCTGGGGAAGCAAGG - Intergenic
970686196 4:18570358-18570380 TTCCCCAGAGTGAGCAAGTAAGG - Intergenic
971863563 4:32140099-32140121 ACCCCCAAACTGGGAAAGAATGG + Intergenic
973575791 4:52288117-52288139 TCTTCCAGACAGAGAAAGAAGGG - Intergenic
973816517 4:54624522-54624544 TCTCTCAGGCTGAGAAAGAAGGG - Intergenic
974522455 4:63000754-63000776 TACCCAAGACTGAGGGAGAAGGG + Intergenic
974814760 4:66989720-66989742 TTCCCCTGGCTGGGGAAGAAAGG + Intergenic
975174598 4:71273274-71273296 TCCCCCACAGTGAAGAAGAGGGG - Intronic
975289390 4:72659244-72659266 TCCCCAACACTGAGAAAGGAAGG + Intergenic
976508781 4:85882982-85883004 TGACCGAGACTGTGGAAGAAAGG + Intronic
977764744 4:100783791-100783813 TCTCCCAGGCTGAGGTGGAAAGG - Intronic
978312212 4:107396948-107396970 TCTCTCAGACAGAGGTAGAAAGG - Intergenic
978777751 4:112520188-112520210 TCCCCAAGCCTCAGAAAGAAAGG + Intergenic
979001979 4:115232914-115232936 TCCCTAAGCCTTAGGAAGAAAGG + Intergenic
981065960 4:140486082-140486104 TCCCTCAGAGTGAGGCAGGAAGG - Intronic
983577169 4:169271481-169271503 TCGCCCAGCCTGGGGAGGAAGGG - Intergenic
984235161 4:177147914-177147936 TCCCCCAGACTGCAGTAGAGTGG - Intergenic
989047292 5:37285252-37285274 TCCCCCAGGCTGGGGTGGAATGG - Intergenic
990457123 5:55998709-55998731 TTCCCCACTCAGAGGAAGAAAGG + Intergenic
992926057 5:81588463-81588485 TGCCCCATACTGAGGCAGTATGG - Intronic
993351338 5:86853624-86853646 TCCTCCCAAGTGAGGAAGAATGG + Intergenic
994447777 5:99899680-99899702 TCCCACTGGCTGAGGATGAAGGG - Intergenic
995784721 5:115816167-115816189 TCGCCCCGTCTGAGGAGGAATGG - Intronic
998394502 5:141809971-141809993 ACCCCCAGCCTGAGCAAGAGTGG - Intergenic
999277191 5:150339105-150339127 TCCCCCAGGCAGAGGGAGAGGGG - Intronic
1000150220 5:158492923-158492945 TACCCCATGCTGAGGAATAATGG + Intergenic
1000489201 5:161888151-161888173 TCCCCTAGACTGTTGAAGGAGGG + Intronic
1001024653 5:168213884-168213906 TCTACCACACTGAGGCAGAAAGG + Intronic
1006236403 6:32637052-32637074 TCACCCAGGCTGAGGTACAATGG - Intronic
1006456079 6:34132856-34132878 TCCCTTAGAGTGAGGAAAAAAGG + Intronic
1006758737 6:36440541-36440563 TCACCCAGCCTGAGCAACAAAGG + Intronic
1006861597 6:37175065-37175087 TCCCCAAGTCAGAGGAGGAAAGG - Exonic
1006924032 6:37644412-37644434 CACCCCAGACTGGGGATGAAGGG - Intronic
1006981320 6:38150525-38150547 TCCCTCAGGCTGAGGAATATAGG + Intronic
1007176234 6:39899491-39899513 TCCCCCACACCTAGGAAGAAGGG + Intronic
1009676906 6:66837413-66837435 TCCCCCAGGCTGAAGTACAATGG + Intergenic
1012518893 6:100096617-100096639 GGCACCAGACTTAGGAAGAAAGG - Intergenic
1013906052 6:115221298-115221320 TCCCACAGAGAGAGGGAGAAAGG + Intergenic
1015912638 6:138183958-138183980 TCCCCCATATTGGGGCAGAAGGG + Intronic
1016577715 6:145588986-145589008 ACCCCCAGGCTGAGGAAAAGTGG + Intronic
1018955426 6:168406892-168406914 CCCCTCAGACAGAGGTAGAATGG + Intergenic
1020780263 7:12509053-12509075 TTCCACAGACTGAGGAAGGATGG - Intergenic
1021450068 7:20776820-20776842 TCCCCCACAGTGGGGAAGGAAGG - Intronic
1023064280 7:36361038-36361060 TTACCCATACTGAGGAAAAAAGG + Intronic
1024408773 7:49014673-49014695 TCCGCCAGTCTGAGAAATAAAGG + Intergenic
1026673292 7:72407923-72407945 TCCTCCAGACTGAAGGAGTAGGG - Intronic
1026706970 7:72702425-72702447 TCCCCCAGGCTGGGGTGGAATGG + Intronic
1027467500 7:78534292-78534314 TGGCCCAGATTGAGGGAGAAAGG - Intronic
1027724835 7:81790954-81790976 TCAACAAGACAGAGGAAGAAAGG - Intergenic
1027961586 7:84952738-84952760 TCCCCCAGTATGAGGAAGGTGGG + Intergenic
1028830599 7:95323221-95323243 TGACCCAGACAGAGGAAGGAAGG - Intronic
1030207528 7:106965508-106965530 TCCACCAACCTGAGGAGGAAGGG - Intergenic
1034546907 7:151795151-151795173 TCCCCCAGAAGGAGGGAGAGTGG + Intronic
1035065427 7:156100873-156100895 TCCCCAAAACTGAGTGAGAATGG + Intergenic
1041090048 8:54293470-54293492 TCCCCCAGACTGAGTAAATTGGG + Intergenic
1041623443 8:59999484-59999506 TCCCACACAGTGAGGAGGAATGG - Intergenic
1041727737 8:61033536-61033558 CCCCCCTGACTGAGGGAGACAGG - Intergenic
1045818966 8:106312380-106312402 TCCGCCAGAGTGAGCAAGACGGG + Intronic
1047825181 8:128565552-128565574 TCACCCACAGTGATGAAGAAGGG + Intergenic
1048422947 8:134295041-134295063 TGCCACAGACTGGGAAAGAAGGG + Intergenic
1049010928 8:139886904-139886926 TCCTGCAGTCTGAGGTAGAATGG + Intronic
1049478728 8:142809997-142810019 TCCCCCAGGCAGAGGAAGCCAGG - Intergenic
1049507194 8:143009049-143009071 TCCCCAAGACTCAGGGAGAATGG - Intergenic
1049715126 8:144086167-144086189 TTCCCCAGAAGGAGGCAGAATGG - Exonic
1050974582 9:11920936-11920958 TCGCCCAGACTGAAGTACAATGG - Intergenic
1052777831 9:32751331-32751353 TCCCCCAGACCCAGGAGGCAAGG - Intergenic
1057297974 9:93860524-93860546 ATCCCCACGCTGAGGAAGAATGG + Intergenic
1057315386 9:93965044-93965066 TCTCCTAGACTGAGCCAGAATGG - Intergenic
1057564566 9:96156379-96156401 TCTCCCAGAGGGAGGAAGGAGGG - Intergenic
1057921667 9:99103625-99103647 TCCCTCAGCCTGAGCAAGAGGGG + Intergenic
1058155403 9:101509127-101509149 ACCCCCAGACTGGGAAGGAATGG - Intronic
1058372743 9:104288662-104288684 TTTCCCAGACAGAGGAAAAAAGG - Intergenic
1060128710 9:121075022-121075044 TCCCGCAGGCTGAGGTAGAGCGG - Exonic
1061001275 9:127904363-127904385 TCTCCCAGACTGTGGGGGAAGGG - Intronic
1061753483 9:132797002-132797024 TCCAAAAGATTGAGGAAGAAAGG + Intronic
1061969511 9:134036310-134036332 TGCCCCAGACAGCTGAAGAAAGG - Exonic
1062338715 9:136084039-136084061 CCCCACAGCCTGAGGAAGAGCGG + Intronic
1185451201 X:281296-281318 TCCCCCGGGCTGATAAAGAATGG + Exonic
1187051603 X:15701861-15701883 TGGCCCAGACTGAGGCAGATGGG - Intronic
1188237843 X:27751412-27751434 TCCCCAGCACTGAGGAAGAATGG - Intergenic
1188678546 X:32973367-32973389 TCACCCAGATTGAAGAGGAAAGG - Intronic
1188869858 X:35359946-35359968 TCCCACCCAGTGAGGAAGAATGG + Intergenic
1190063928 X:47227424-47227446 TCCCCCAGACTGAGGAAGAATGG - Exonic
1190454688 X:50616231-50616253 TCCTCCAGAATGAAGAAAAAGGG - Intronic
1190724725 X:53181422-53181444 CCCCATAGACTGGGGAAGAAGGG - Intergenic
1193578800 X:83236016-83236038 TCCACAAGACAGAGAAAGAAGGG + Intergenic
1193739750 X:85203274-85203296 TCCCACCCAGTGAGGAAGAATGG + Intergenic
1194608080 X:96006099-96006121 TCCCACTCAGTGAGGAAGAATGG - Intergenic
1195104844 X:101593843-101593865 CCCCCCACAGTGAGGAGGAAGGG + Intergenic
1196140451 X:112255806-112255828 TCCAGGAGACAGAGGAAGAACGG - Intergenic
1196304373 X:114084664-114084686 TCACCCAGACTGGAGAACAATGG + Intergenic
1196674465 X:118405073-118405095 TCGCCCAGACTGGGGTGGAATGG + Intronic
1197374060 X:125660795-125660817 TCCCACAGACTGGGGTAGAAAGG + Intergenic
1197913819 X:131513824-131513846 TTCCCCAGACTGAGGACAACAGG + Intergenic
1200751052 Y:6944567-6944589 TGCCACAGACTGGGGAAGTAGGG - Intronic