ID: 1190066549

View in Genome Browser
Species Human (GRCh38)
Location X:47245328-47245350
Sequence CAACCAGATGGCCGGCTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 1, 2: 0, 3: 5, 4: 110}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190066549_1190066552 -3 Left 1190066549 X:47245328-47245350 CCTCACAGCCGGCCATCTGGTTG 0: 1
1: 1
2: 0
3: 5
4: 110
Right 1190066552 X:47245348-47245370 TTGTCTGTTCACCCAATCCTAGG 0: 1
1: 0
2: 0
3: 4
4: 127
1190066549_1190066558 23 Left 1190066549 X:47245328-47245350 CCTCACAGCCGGCCATCTGGTTG 0: 1
1: 1
2: 0
3: 5
4: 110
Right 1190066558 X:47245374-47245396 ACGTGAAGCATGACTGCGTCGGG 0: 1
1: 0
2: 0
3: 2
4: 51
1190066549_1190066553 -2 Left 1190066549 X:47245328-47245350 CCTCACAGCCGGCCATCTGGTTG 0: 1
1: 1
2: 0
3: 5
4: 110
Right 1190066553 X:47245349-47245371 TGTCTGTTCACCCAATCCTAGGG 0: 1
1: 0
2: 0
3: 4
4: 74
1190066549_1190066557 22 Left 1190066549 X:47245328-47245350 CCTCACAGCCGGCCATCTGGTTG 0: 1
1: 1
2: 0
3: 5
4: 110
Right 1190066557 X:47245373-47245395 TACGTGAAGCATGACTGCGTCGG 0: 1
1: 0
2: 0
3: 7
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190066549 Original CRISPR CAACCAGATGGCCGGCTGTG AGG (reversed) Intronic
900401146 1:2473446-2473468 CACCCAGATGGGCGGATGGGTGG - Intronic
901322908 1:8350223-8350245 CAACCGGATGGCCAAATGTGCGG + Intergenic
902076718 1:13792932-13792954 GAACCAGATGGCTGGGTTTGGGG - Intronic
904566995 1:31434205-31434227 GCACCAGATGGCAGGCTGTGAGG - Exonic
910228885 1:84965933-84965955 GAACAAGATGGGTGGCTGTGTGG - Intronic
911162755 1:94698036-94698058 GAGCCAGATGGCCCTCTGTGAGG - Intergenic
913540562 1:119816259-119816281 CAGCCAGATGGGCAGCAGTGTGG + Intergenic
915604414 1:156941651-156941673 TAGCCAGGTGGCAGGCTGTGGGG + Intronic
919280702 1:195485449-195485471 GAACCAGCCAGCCGGCTGTGTGG + Intergenic
1065122330 10:22542127-22542149 CACCCAGAGGGAAGGCTGTGGGG + Intronic
1065879771 10:30028584-30028606 CAACCAGAGAGACCGCTGTGTGG - Exonic
1070320828 10:75353442-75353464 CAGCCAGATGGAGGGCAGTGCGG + Intergenic
1071823119 10:89297850-89297872 AAGCCAGATGGCCGCCTGTCTGG + Intronic
1071908406 10:90201357-90201379 CAAAAAGATGGCTGGCTTTGTGG - Intergenic
1073124429 10:101140772-101140794 CAACCAGAGGGCCAGATCTGAGG - Intergenic
1076824122 10:132958793-132958815 CAGCCAGGTGACAGGCTGTGCGG + Intergenic
1079100834 11:17541011-17541033 CAAGCAGATGCCCGCCTGTATGG - Intronic
1083144671 11:60749349-60749371 CTGCCAGATGGGTGGCTGTGAGG - Intergenic
1084914037 11:72414357-72414379 CAGCCAGGAGGCCTGCTGTGGGG - Intronic
1088599589 11:111462763-111462785 CAAGCAGCTGGCCGGCTGCAGGG + Intergenic
1088708799 11:112487625-112487647 CATCTAGATGGCTGGGTGTGGGG + Intergenic
1090918186 11:131185564-131185586 CAACCACATGGCCAGCAGGGAGG - Intergenic
1091991772 12:4961281-4961303 GAACCAGAGGGACAGCTGTGTGG - Intergenic
1093784407 12:23175783-23175805 CAGCCAGATGGTCGTCTGGGCGG - Intergenic
1097008341 12:55934965-55934987 AGACCAGATGGCGGGGTGTGAGG + Intronic
1100230854 12:92605527-92605549 CAACTAGATGGCCCCATGTGGGG - Intergenic
1104949253 12:132431636-132431658 GAACCAGCTGCCAGGCTGTGTGG + Intergenic
1109784587 13:67156833-67156855 CATACAGACGGCAGGCTGTGGGG - Intronic
1110274708 13:73630772-73630794 CAACTAGATGGTCGCCTCTGTGG + Intergenic
1112482656 13:99791281-99791303 CCACCACAGGGCCAGCTGTGAGG + Intronic
1119810795 14:77517465-77517487 CAACTAGATGCCTGGCAGTGTGG + Intronic
1121990116 14:98549054-98549076 CAGCCTGATGGCCCGCTCTGCGG - Intergenic
1131584046 15:93674121-93674143 CTACCAGGTTGCCGGCAGTGTGG + Intergenic
1134893453 16:17862197-17862219 GAACCAGATTGCCCTCTGTGGGG + Intergenic
1142362977 16:89636010-89636032 CAAGCTGAGGGCCGGCTTTGTGG + Exonic
1143110262 17:4548915-4548937 CCAACAGATGGGAGGCTGTGTGG + Intronic
1144966331 17:19078977-19078999 GAGCCAGATTGCCAGCTGTGTGG - Intergenic
1144981587 17:19173080-19173102 GAGCCAGATTGCCAGCTGTGTGG + Intergenic
1144986637 17:19205159-19205181 GAGCCAGATTGCCAGCTGTGTGG - Intergenic
1146560025 17:33860078-33860100 CCACCAGATGGGTGGCTCTGAGG + Intronic
1150069669 17:62140138-62140160 CAAGCAGATGGCCGGGTGCCTGG - Intergenic
1150265695 17:63831187-63831209 CAACCAGCTCGACGGCTTTGAGG + Exonic
1153499391 18:5732718-5732740 CAACCTGGTGGCCTGCTCTGGGG - Intergenic
1153643081 18:7172350-7172372 CAAGGAGAAGGCCGGCAGTGGGG - Intergenic
1157821684 18:50775897-50775919 GAACCAGACAGCCAGCTGTGCGG - Intergenic
1160728539 19:629836-629858 CAAGCAGATGGCCGGGTGCCTGG - Exonic
1161558667 19:4958412-4958434 CAGGCAGAGGGCTGGCTGTGGGG + Intronic
1162053795 19:8050884-8050906 AAACCACATGGCCGGGTGAGTGG - Intronic
1163639394 19:18452773-18452795 CAACAGGATGGCCAGATGTGTGG + Intronic
1163692007 19:18743279-18743301 ACACCTGTTGGCCGGCTGTGCGG + Intronic
1164594700 19:29525624-29525646 CAACCAGCTGCCCCGCTGTTTGG - Intergenic
1165484774 19:36089048-36089070 CATCCAGATGATCAGCTGTGGGG + Exonic
1166884959 19:45954556-45954578 CCACCAGATGGAGGGCTGAGGGG + Intronic
1168309570 19:55453576-55453598 CACCAAGATGGCAGGCAGTGAGG - Intronic
925203934 2:1990924-1990946 GACCCAGATGGCCGCCTGTGAGG - Intronic
928798919 2:35062729-35062751 CTATCAGATGGCCACCTGTGAGG + Intergenic
931912257 2:66913272-66913294 GAATCACATGGCCTGCTGTGTGG + Intergenic
937305389 2:120867546-120867568 CACCCAGAGGGGCGGCGGTGCGG - Intronic
941615356 2:167712460-167712482 CAGCCAGATGGCAGCCTGGGGGG + Intergenic
946186746 2:217985243-217985265 CAAGCAGATGGGCTCCTGTGTGG + Intronic
947532146 2:230916272-230916294 CAACTATTTGGCAGGCTGTGTGG + Intronic
947770715 2:232668140-232668162 CTACCACATGCCCGGCTTTGTGG + Intronic
947821774 2:233076859-233076881 CAGCCAGTTGGCAGGGTGTGGGG + Intronic
1170906974 20:20525028-20525050 AAAGCAGAGGGCCAGCTGTGTGG + Intronic
1173801243 20:45895871-45895893 CAATGTGATGGCCGGGTGTGGGG - Intronic
1174042772 20:47711509-47711531 CAGCCAGATGGCCCGTCGTGGGG - Intronic
1174389292 20:50207951-50207973 CAACTAGAGGGCAGCCTGTGTGG + Intergenic
1175912190 20:62410317-62410339 CAAACAGATGTCTGGCAGTGAGG - Exonic
1176101936 20:63368379-63368401 CAGCCAGAGGGCAGGGTGTGAGG - Intronic
1179571054 21:42279168-42279190 CAAGCTGAGGGGCGGCTGTGGGG + Intronic
1180175300 21:46084296-46084318 CAGCCACAGGGCCGGGTGTGGGG - Intergenic
1181266613 22:21634435-21634457 CAGCCTCATGGCCGGCTGTCTGG + Exonic
1183590642 22:38777476-38777498 CAACCAGATGGTCAGCCTTGAGG + Intronic
1183958012 22:41394015-41394037 CAACCAGGTGTCTGGGTGTGTGG + Intronic
1184461184 22:44639126-44639148 CCAGCAGACGGCGGGCTGTGAGG - Intergenic
954583420 3:51715803-51715825 CAGGCAGATGGCCACCTGTGAGG - Exonic
957367502 3:79245494-79245516 CAACCAGCTGGCTAGCTTTGAGG + Intronic
961010692 3:123433784-123433806 CCACCAGAAGACGGGCTGTGCGG + Intronic
961431774 3:126888945-126888967 CAACCGGAAGGCCTGCTGTGGGG - Intronic
961777927 3:129303144-129303166 CAAACAGAAGGCCTGCAGTGGGG + Intronic
967881750 3:194306430-194306452 CAACCCCAGGGCCCGCTGTGGGG + Intergenic
973829728 4:54746591-54746613 CACCCAGGTGGCCTGTTGTGTGG - Intergenic
979011555 4:115377015-115377037 CAACCATGTGGCATGCTGTGGGG + Intergenic
979860038 4:125682534-125682556 CAAACAGACAGCAGGCTGTGGGG + Intergenic
984594401 4:181651310-181651332 CAACCTGATGGCCGGCACGGTGG + Intergenic
987835173 5:23151157-23151179 CAACCAGATGGTCCCATGTGGGG - Intergenic
992002892 5:72452524-72452546 AAACCAGATGGGGGGCTTTGAGG - Intronic
996574161 5:124963430-124963452 CAACCAGCCAGCCCGCTGTGCGG - Intergenic
999742740 5:154568877-154568899 CATCCAGATGCCAGGCTTTGAGG - Intergenic
1003704190 6:8506205-8506227 CATCCAAATGGCCTGCTGGGTGG + Intergenic
1003892138 6:10572972-10572994 CAGGCAAATGGCCGGCTCTGTGG + Intronic
1007152939 6:39712787-39712809 CAACCACATGACAGGCTCTGGGG - Intronic
1007371656 6:41430156-41430178 CAGCCAAGTGGGCGGCTGTGTGG + Intergenic
1015919761 6:138255013-138255035 CAACCAGCTGGCTGCCTGTGGGG - Intronic
1018710391 6:166494616-166494638 AAACCTGGTGGCCGGCTGCGTGG - Intronic
1020825082 7:13016824-13016846 CATACAGACGGCAGGCTGTGAGG - Intergenic
1022374732 7:29802815-29802837 CAACTAGATGGCGGGGGGTGGGG + Intergenic
1022710875 7:32848788-32848810 CAACCAAATGGCAGGCAGTCAGG - Intergenic
1022913778 7:34926138-34926160 CAACCAAATGGCAGGCAGTCAGG + Intergenic
1026403542 7:70040690-70040712 CAACAACATGGCATGCTGTGTGG + Intronic
1027189841 7:75990171-75990193 GAACCAGATGGCGAGCTGAGTGG - Intronic
1030502733 7:110380423-110380445 CAGCCAGTTGGCCCGGTGTGGGG - Intergenic
1030958146 7:115881064-115881086 AAACCTGGTGGCCGTCTGTGGGG - Intergenic
1033219960 7:139521253-139521275 CAACCAGATGGCCAGCTGTGGGG - Intergenic
1033570089 7:142619062-142619084 CAACCAGGTGCTCTGCTGTGTGG + Intergenic
1042282149 8:67065842-67065864 CTGCCAGATGGCCGCCTGGGAGG + Intronic
1056114859 9:83432160-83432182 CATCCAGAGGGCCGGATGTGGGG - Intronic
1057937613 9:99253940-99253962 CAAACAGATGGCCCCGTGTGGGG + Intergenic
1061965262 9:134010258-134010280 GTACCAGATGGACAGCTGTGGGG + Intergenic
1187557723 X:20368020-20368042 CAACCAGATGGTCCCATGTGAGG - Intergenic
1190062207 X:47218869-47218891 CAAGCTCATGGCCGGCTGAGCGG + Intronic
1190066549 X:47245328-47245350 CAACCAGATGGCCGGCTGTGAGG - Intronic
1196972730 X:121126929-121126951 CAACCAGTTAGGAGGCTGTGAGG - Intergenic
1198978236 X:142361837-142361859 CAACCTGCTGGCCGGCTCTTTGG - Intergenic
1200225084 X:154412712-154412734 TAACCAGATGGCCGGGTGGAGGG + Intronic
1200251542 X:154556800-154556822 CCACCAGAGGTCCAGCTGTGTGG + Intronic
1200266225 X:154647616-154647638 CCACCAGAGGTCCAGCTGTGTGG - Intergenic