ID: 1190068205

View in Genome Browser
Species Human (GRCh38)
Location X:47257753-47257775
Sequence CAGAATGTGCAACTTTTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190068205_1190068215 22 Left 1190068205 X:47257753-47257775 CCTTTTAAAAGTTGCACATTCTG No data
Right 1190068215 X:47257798-47257820 TGTAATCCGAGCACTTTGGGAGG 0: 802
1: 313059
2: 266985
3: 145909
4: 129531
1190068205_1190068217 28 Left 1190068205 X:47257753-47257775 CCTTTTAAAAGTTGCACATTCTG No data
Right 1190068217 X:47257804-47257826 CCGAGCACTTTGGGAGGCTGAGG 0: 271
1: 92706
2: 215689
3: 239573
4: 263016
1190068205_1190068213 19 Left 1190068205 X:47257753-47257775 CCTTTTAAAAGTTGCACATTCTG No data
Right 1190068213 X:47257795-47257817 GCCTGTAATCCGAGCACTTTGGG 0: 582
1: 233618
2: 278681
3: 180060
4: 136485
1190068205_1190068212 18 Left 1190068205 X:47257753-47257775 CCTTTTAAAAGTTGCACATTCTG No data
Right 1190068212 X:47257794-47257816 CGCCTGTAATCCGAGCACTTTGG 0: 291
1: 130499
2: 284220
3: 222170
4: 146546
1190068205_1190068210 -9 Left 1190068205 X:47257753-47257775 CCTTTTAAAAGTTGCACATTCTG No data
Right 1190068210 X:47257767-47257789 CACATTCTGGCCGGGCGCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190068205 Original CRISPR CAGAATGTGCAACTTTTAAA AGG (reversed) Intergenic
No off target data available for this crispr